ID: 1128779362

View in Genome Browser
Species Human (GRCh38)
Location 15:70348715-70348737
Sequence ACTGGGACGCAAAGCAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128779362_1128779365 -10 Left 1128779362 15:70348715-70348737 CCCACACTGCTTTGCGTCCCAGT No data
Right 1128779365 15:70348728-70348750 GCGTCCCAGTTCTGTCCTCTGGG No data
1128779362_1128779366 -9 Left 1128779362 15:70348715-70348737 CCCACACTGCTTTGCGTCCCAGT No data
Right 1128779366 15:70348729-70348751 CGTCCCAGTTCTGTCCTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128779362 Original CRISPR ACTGGGACGCAAAGCAGTGT GGG (reversed) Intergenic
No off target data available for this crispr