ID: 1128783921

View in Genome Browser
Species Human (GRCh38)
Location 15:70380763-70380785
Sequence CTCTGGATGCAGATGAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128783921_1128783925 -9 Left 1128783921 15:70380763-70380785 CCCAGCTTCATCTGCATCCAGAG No data
Right 1128783925 15:70380777-70380799 CATCCAGAGAAAGGAAGGCAAGG No data
1128783921_1128783929 2 Left 1128783921 15:70380763-70380785 CCCAGCTTCATCTGCATCCAGAG No data
Right 1128783929 15:70380788-70380810 AGGAAGGCAAGGAAGCTGGGTGG No data
1128783921_1128783928 -1 Left 1128783921 15:70380763-70380785 CCCAGCTTCATCTGCATCCAGAG No data
Right 1128783928 15:70380785-70380807 GAAAGGAAGGCAAGGAAGCTGGG No data
1128783921_1128783932 29 Left 1128783921 15:70380763-70380785 CCCAGCTTCATCTGCATCCAGAG No data
Right 1128783932 15:70380815-70380837 TTGGATGAGAGCCACAAGCTAGG No data
1128783921_1128783927 -2 Left 1128783921 15:70380763-70380785 CCCAGCTTCATCTGCATCCAGAG No data
Right 1128783927 15:70380784-70380806 AGAAAGGAAGGCAAGGAAGCTGG No data
1128783921_1128783930 10 Left 1128783921 15:70380763-70380785 CCCAGCTTCATCTGCATCCAGAG No data
Right 1128783930 15:70380796-70380818 AAGGAAGCTGGGTGGTGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128783921 Original CRISPR CTCTGGATGCAGATGAAGCT GGG (reversed) Intergenic
No off target data available for this crispr