ID: 1128784908

View in Genome Browser
Species Human (GRCh38)
Location 15:70387671-70387693
Sequence CCAGTGAGGAAACTTGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128784905_1128784908 14 Left 1128784905 15:70387634-70387656 CCATTTCTGTGCATCATGTATTA No data
Right 1128784908 15:70387671-70387693 CCAGTGAGGAAACTTGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128784908 Original CRISPR CCAGTGAGGAAACTTGTGTC TGG Intergenic
No off target data available for this crispr