ID: 1128786795

View in Genome Browser
Species Human (GRCh38)
Location 15:70403542-70403564
Sequence TCCATATGGTGACAGTGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128786795_1128786800 6 Left 1128786795 15:70403542-70403564 CCCCCACACTGTCACCATATGGA No data
Right 1128786800 15:70403571-70403593 AGCCCATCTTCCCATGTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128786795 Original CRISPR TCCATATGGTGACAGTGTGG GGG (reversed) Intergenic
No off target data available for this crispr