ID: 1128790418

View in Genome Browser
Species Human (GRCh38)
Location 15:70429427-70429449
Sequence ATGTGGGTATTGCTGTCAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128790418_1128790425 27 Left 1128790418 15:70429427-70429449 CCGTCTGACAGCAATACCCACAT No data
Right 1128790425 15:70429477-70429499 TATCATTAGGTTAAGTCACTGGG No data
1128790418_1128790423 14 Left 1128790418 15:70429427-70429449 CCGTCTGACAGCAATACCCACAT No data
Right 1128790423 15:70429464-70429486 GTGATAAATGAACTATCATTAGG No data
1128790418_1128790424 26 Left 1128790418 15:70429427-70429449 CCGTCTGACAGCAATACCCACAT No data
Right 1128790424 15:70429476-70429498 CTATCATTAGGTTAAGTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128790418 Original CRISPR ATGTGGGTATTGCTGTCAGA CGG (reversed) Intergenic
No off target data available for this crispr