ID: 1128791361

View in Genome Browser
Species Human (GRCh38)
Location 15:70436744-70436766
Sequence GATGGAGATAATCTGAGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128791361_1128791364 6 Left 1128791361 15:70436744-70436766 CCAAAACTCAGATTATCTCCATC No data
Right 1128791364 15:70436773-70436795 CTCTGCTACCCTCAGTCTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128791361 Original CRISPR GATGGAGATAATCTGAGTTT TGG (reversed) Intergenic
No off target data available for this crispr