ID: 1128791364

View in Genome Browser
Species Human (GRCh38)
Location 15:70436773-70436795
Sequence CTCTGCTACCCTCAGTCTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128791359_1128791364 26 Left 1128791359 15:70436724-70436746 CCAGCAGCTACCTTACATCACCA No data
Right 1128791364 15:70436773-70436795 CTCTGCTACCCTCAGTCTGTCGG No data
1128791361_1128791364 6 Left 1128791361 15:70436744-70436766 CCAAAACTCAGATTATCTCCATC No data
Right 1128791364 15:70436773-70436795 CTCTGCTACCCTCAGTCTGTCGG No data
1128791360_1128791364 16 Left 1128791360 15:70436734-70436756 CCTTACATCACCAAAACTCAGAT No data
Right 1128791364 15:70436773-70436795 CTCTGCTACCCTCAGTCTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128791364 Original CRISPR CTCTGCTACCCTCAGTCTGT CGG Intergenic
No off target data available for this crispr