ID: 1128797783

View in Genome Browser
Species Human (GRCh38)
Location 15:70477977-70477999
Sequence GCTCTTGGGAGTGGGGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128797783_1128797790 -10 Left 1128797783 15:70477977-70477999 CCCAGCACCCCACTCCCAAGAGC No data
Right 1128797790 15:70477990-70478012 TCCCAAGAGCCCACATGGCAGGG No data
1128797783_1128797797 0 Left 1128797783 15:70477977-70477999 CCCAGCACCCCACTCCCAAGAGC No data
Right 1128797797 15:70478000-70478022 CCACATGGCAGGGCAGGGCCTGG No data
1128797783_1128797793 -6 Left 1128797783 15:70477977-70477999 CCCAGCACCCCACTCCCAAGAGC No data
Right 1128797793 15:70477994-70478016 AAGAGCCCACATGGCAGGGCAGG No data
1128797783_1128797794 -5 Left 1128797783 15:70477977-70477999 CCCAGCACCCCACTCCCAAGAGC No data
Right 1128797794 15:70477995-70478017 AGAGCCCACATGGCAGGGCAGGG No data
1128797783_1128797799 10 Left 1128797783 15:70477977-70477999 CCCAGCACCCCACTCCCAAGAGC No data
Right 1128797799 15:70478010-70478032 GGGCAGGGCCTGGAGACTGGAGG No data
1128797783_1128797800 11 Left 1128797783 15:70477977-70477999 CCCAGCACCCCACTCCCAAGAGC No data
Right 1128797800 15:70478011-70478033 GGCAGGGCCTGGAGACTGGAGGG No data
1128797783_1128797798 7 Left 1128797783 15:70477977-70477999 CCCAGCACCCCACTCCCAAGAGC No data
Right 1128797798 15:70478007-70478029 GCAGGGCAGGGCCTGGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128797783 Original CRISPR GCTCTTGGGAGTGGGGTGCT GGG (reversed) Intergenic