ID: 1128797988

View in Genome Browser
Species Human (GRCh38)
Location 15:70478818-70478840
Sequence CTGGAGAACGGGACAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128797976_1128797988 7 Left 1128797976 15:70478788-70478810 CCACAGACACCCAGGCTCAGGGA No data
Right 1128797988 15:70478818-70478840 CTGGAGAACGGGACAGAGGAGGG No data
1128797981_1128797988 -3 Left 1128797981 15:70478798-70478820 CCAGGCTCAGGGAGAGGGGCCTG No data
Right 1128797988 15:70478818-70478840 CTGGAGAACGGGACAGAGGAGGG No data
1128797980_1128797988 -2 Left 1128797980 15:70478797-70478819 CCCAGGCTCAGGGAGAGGGGCCT No data
Right 1128797988 15:70478818-70478840 CTGGAGAACGGGACAGAGGAGGG No data
1128797971_1128797988 28 Left 1128797971 15:70478767-70478789 CCTGCTCAGTCAGCTGGTCCTCC No data
Right 1128797988 15:70478818-70478840 CTGGAGAACGGGACAGAGGAGGG No data
1128797973_1128797988 10 Left 1128797973 15:70478785-70478807 CCTCCACAGACACCCAGGCTCAG No data
Right 1128797988 15:70478818-70478840 CTGGAGAACGGGACAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128797988 Original CRISPR CTGGAGAACGGGACAGAGGA GGG Intergenic
No off target data available for this crispr