ID: 1128800863

View in Genome Browser
Species Human (GRCh38)
Location 15:70496080-70496102
Sequence CACCTGTAGAAGCTGCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128800863_1128800874 23 Left 1128800863 15:70496080-70496102 CCCAGCTGCAGCTTCTACAGGTG No data
Right 1128800874 15:70496126-70496148 GCCAAACCTGCTCCTGTAGGGGG No data
1128800863_1128800866 -9 Left 1128800863 15:70496080-70496102 CCCAGCTGCAGCTTCTACAGGTG No data
Right 1128800866 15:70496094-70496116 CTACAGGTGGAGAGTAAACCAGG No data
1128800863_1128800867 -5 Left 1128800863 15:70496080-70496102 CCCAGCTGCAGCTTCTACAGGTG No data
Right 1128800867 15:70496098-70496120 AGGTGGAGAGTAAACCAGGCTGG No data
1128800863_1128800872 21 Left 1128800863 15:70496080-70496102 CCCAGCTGCAGCTTCTACAGGTG No data
Right 1128800872 15:70496124-70496146 ACGCCAAACCTGCTCCTGTAGGG No data
1128800863_1128800873 22 Left 1128800863 15:70496080-70496102 CCCAGCTGCAGCTTCTACAGGTG No data
Right 1128800873 15:70496125-70496147 CGCCAAACCTGCTCCTGTAGGGG No data
1128800863_1128800871 20 Left 1128800863 15:70496080-70496102 CCCAGCTGCAGCTTCTACAGGTG No data
Right 1128800871 15:70496123-70496145 CACGCCAAACCTGCTCCTGTAGG No data
1128800863_1128800868 -4 Left 1128800863 15:70496080-70496102 CCCAGCTGCAGCTTCTACAGGTG No data
Right 1128800868 15:70496099-70496121 GGTGGAGAGTAAACCAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128800863 Original CRISPR CACCTGTAGAAGCTGCAGCT GGG (reversed) Intergenic
No off target data available for this crispr