ID: 1128802205

View in Genome Browser
Species Human (GRCh38)
Location 15:70504071-70504093
Sequence CCTGCTGGAGACCTTGCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 198}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128802197_1128802205 -8 Left 1128802197 15:70504056-70504078 CCACCGTGCTCCCAGCCTGCTGG 0: 1
1: 0
2: 1
3: 46
4: 493
Right 1128802205 15:70504071-70504093 CCTGCTGGAGACCTTGCTTGGGG 0: 1
1: 0
2: 1
3: 22
4: 198
1128802196_1128802205 -2 Left 1128802196 15:70504050-70504072 CCATTTCCACCGTGCTCCCAGCC 0: 1
1: 0
2: 1
3: 37
4: 331
Right 1128802205 15:70504071-70504093 CCTGCTGGAGACCTTGCTTGGGG 0: 1
1: 0
2: 1
3: 22
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128802205 Original CRISPR CCTGCTGGAGACCTTGCTTG GGG Intergenic
901426137 1:9183144-9183166 CAGGCTGGGGACCTTGCGTGGGG + Intergenic
902329725 1:15725371-15725393 CCTGGTGGAGGCCTTGCTGCTGG - Exonic
903154419 1:21434429-21434451 CCTGCTGCAGACCCAGCTGGAGG + Intergenic
904033605 1:27547822-27547844 CCCCCTGGAGTCCATGCTTGAGG + Exonic
905124454 1:35707488-35707510 CCTGCTGGAGACGGAGGTTGGGG + Intergenic
913592669 1:120343075-120343097 CCTGCTGGAGACCTCTCCTAGGG - Intergenic
913650682 1:120912055-120912077 CCTGCTGGAGACCTCTCCTAGGG + Intergenic
914170431 1:145217012-145217034 CCTGCTGGAGACCTCTCCTAGGG - Intergenic
914525547 1:148460978-148461000 CCTGCTGGAGACCTCTCCTAGGG - Intergenic
916742819 1:167661328-167661350 CCTGGTGGAGTCCCTGGTTGAGG + Intronic
917301304 1:173577201-173577223 CCTGCTGGAGACCATCACTGAGG + Intronic
917528023 1:175806781-175806803 CCTGCTGGAGACCTTAGCTGAGG - Intergenic
919014247 1:192009911-192009933 CCTCCTGAAGAACCTGCTTGAGG + Intergenic
920440188 1:205975689-205975711 CCTGCTTGAGGCATTGCCTGTGG + Intergenic
921010326 1:211134253-211134275 CCTGCGGGAGACCAAGCTGGGGG + Intergenic
921669537 1:217910796-217910818 CATTCTGCACACCTTGCTTGTGG - Intergenic
922979845 1:229816452-229816474 CCTGCTGGTGACCTTGCTGGGGG + Intergenic
923088607 1:230721033-230721055 GATGCTGGAGGCCTTGCTTGGGG - Intergenic
1063957325 10:11279517-11279539 ACTGCTGGAGACTCAGCTTGGGG - Intronic
1064642352 10:17427439-17427461 CCTGATGGAGACCTGGGATGGGG + Intronic
1066413182 10:35193535-35193557 CCTGCTGGAGCCCCAGATTGAGG + Intronic
1066697262 10:38090573-38090595 CCTGCTGGAGACTCAGCTTCAGG + Intergenic
1069054607 10:63831684-63831706 ACTGCTGGAGACAGGGCTTGGGG + Intergenic
1072935367 10:99707234-99707256 ACTCCTGGAGACCTTGCTCATGG - Intronic
1075668927 10:124249830-124249852 AGTGGTGTAGACCTTGCTTGTGG + Intergenic
1076186574 10:128454845-128454867 TCTCCTGGAGCCCTTGCTTCTGG + Intergenic
1076765832 10:132632535-132632557 CCTGCTGGACCCCTTCCTGGCGG - Intronic
1077334235 11:1996406-1996428 CCAGCTGGAGACCTGGCTGTGGG + Intergenic
1077441354 11:2570621-2570643 CCTGCAGGAGATCGTGCTGGTGG + Exonic
1078585830 11:12587865-12587887 GCTGCTAGAGACCTAGCTGGAGG - Intergenic
1081867228 11:46366577-46366599 CCTGCTGTTGACCGGGCTTGTGG + Exonic
1082645184 11:55715035-55715057 ACTGCTGGAGAACTTGGTTGTGG + Intergenic
1082646006 11:55726453-55726475 ACTGCTGGAGAACTTGGTTGTGG + Intergenic
1082649663 11:55773683-55773705 ACTGTTGGAGAACTTGGTTGTGG + Exonic
1082650605 11:55787210-55787232 ACTGCTGGAGAACTTGGTTGTGG + Intergenic
1082862343 11:57868282-57868304 CCTGGTGGAGACTTTGTATGGGG + Intergenic
1084605088 11:70167717-70167739 GCTGATGGAGACCGTGCCTGGGG - Intronic
1085937864 11:81171749-81171771 CCTGCTGAAGAACTTGCTGAAGG - Intergenic
1086643537 11:89190212-89190234 CCTCCTGGAGAGCCTGCCTGAGG - Intronic
1088971592 11:114779330-114779352 CCTGCTGGGGCCCTGGCCTGGGG + Intergenic
1202817218 11_KI270721v1_random:51588-51610 CCAGCTGGAGACCTGGCTGTGGG + Intergenic
1091634466 12:2186572-2186594 TGTGCTGGAGACATTGCTTATGG + Intronic
1091899592 12:4134300-4134322 CCAGCTGGGGCCATTGCTTGGGG - Intergenic
1092112341 12:5972547-5972569 CCTGCTGGGGAGAGTGCTTGGGG - Intronic
1094837952 12:34331021-34331043 CTTCCAGGAGACCTTGCGTGGGG - Intergenic
1095316575 12:40769036-40769058 CCTTCTGTAGACCCTGCTTTGGG - Intronic
1096294956 12:50376081-50376103 CCTGCAGCAGAACCTGCTTGTGG - Intronic
1102338829 12:112105647-112105669 TGTGTTGGAAACCTTGCTTGGGG - Intronic
1102349243 12:112179991-112180013 CCTTCTGGAGTGCTTGTTTGGGG - Intronic
1105705765 13:22966589-22966611 CCTGCTGTAGACCTACCTTATGG - Intergenic
1105858669 13:24391574-24391596 CCTGCTGTAGACCTACCTTATGG - Intergenic
1107735609 13:43395738-43395760 CCTGCTGGGCTCCATGCTTGTGG - Intronic
1107844783 13:44500623-44500645 CCAGATGGAGACCTTTCTTTTGG - Intronic
1108041821 13:46346375-46346397 TCTCCTGGAATCCTTGCTTGCGG + Intronic
1110637759 13:77786382-77786404 CCTGCTGGAGATGTTGCTCTTGG + Intergenic
1113817521 13:113184695-113184717 CCTGCAGGAGCCCATGCTGGTGG + Intronic
1113817568 13:113184893-113184915 CCTGCAGGAGCCCGTGCTTGTGG + Intronic
1117316416 14:54575321-54575343 CCTGTTAGAGCCCTTGCTTAGGG + Intronic
1118642773 14:67807752-67807774 CCTGCTGGAGCTCCTGCTTGAGG - Exonic
1119555304 14:75548136-75548158 CCTGCTGCAGGCTTTGCTCGTGG - Intergenic
1120522173 14:85536188-85536210 CCTGCTGGAGAGTTTGATTTAGG + Intronic
1120693751 14:87621460-87621482 CCTGGTGGAGACCCTGTGTGGGG + Intergenic
1121461405 14:94081314-94081336 CCGGCGGGAGAGCTGGCTTGGGG + Exonic
1121961522 14:98264538-98264560 CCTGCTGAACACCTTGATTGTGG + Intergenic
1125322607 15:38504592-38504614 CCTTCTGGAGGACTTGCCTGAGG + Intronic
1126336626 15:47592087-47592109 ACTGCTGGAGACCTAGATTAGGG - Intronic
1127867753 15:63045509-63045531 CCTGCTGGAGAATTTGCGGGAGG - Intronic
1128309228 15:66620189-66620211 CCAGGGGGAGACCTTGGTTGGGG - Intronic
1128486449 15:68095354-68095376 CCAGCTGGAGGACTTGGTTGTGG + Intronic
1128802205 15:70504071-70504093 CCTGCTGGAGACCTTGCTTGGGG + Intergenic
1131405369 15:92160116-92160138 CCTCCTTGTGACCTTTCTTGAGG - Intronic
1132037830 15:98501431-98501453 CCTGCTGGCAACTTCGCTTGGGG + Intronic
1132591917 16:729810-729832 CCTGGTGGGGACCTGGCTGGGGG + Exonic
1132926532 16:2432583-2432605 CCCGCTGGAGGCCTTGCTAGTGG - Intronic
1134282672 16:12831630-12831652 CCTGCTGGAGAGTTTGCATGTGG + Intergenic
1137013807 16:35352430-35352452 CCTGCTGCAGACCCTGCTTCAGG + Intergenic
1137596359 16:49726660-49726682 CCTAATGGAGACATTGTTTGTGG - Intronic
1137769463 16:51004438-51004460 CCTGCTGAAGAACCTGCTTCAGG - Intergenic
1139478709 16:67216387-67216409 CATGTTGGTGACCTTGCTGGAGG - Intronic
1140275464 16:73504794-73504816 GCTGCTGGAGTGCTTGGTTGGGG + Intergenic
1141071111 16:80955190-80955212 CCTGCTGGTGACTATGCTTGTGG - Intergenic
1141425172 16:83940196-83940218 CCTCCTGGAAGCCTTCCTTGGGG - Intronic
1141426129 16:83945906-83945928 CCTGCTGATGACCCTGGTTGGGG - Intronic
1141434639 16:83993020-83993042 CATGGTGGGGACCTTACTTGGGG + Intronic
1142279897 16:89142322-89142344 CCTGCTGTAGGCCTTGTTTGGGG - Intronic
1142314541 16:89335284-89335306 CCTGTTGCAGCCCCTGCTTGGGG - Intronic
1143196580 17:5080387-5080409 CCTGCTGGAGCTCTTGGATGAGG + Intronic
1143736776 17:8916604-8916626 CTTGCTGGGGACCCTGCATGGGG + Intronic
1144778492 17:17796502-17796524 GCTGCTGGAGACCTTGAATGTGG - Exonic
1144942715 17:18952583-18952605 CCAGCTGGAGTCCTTGGGTGTGG + Intronic
1146968102 17:37049954-37049976 GGTTCTGGAGACCTTGCTTTTGG + Intronic
1149782215 17:59407118-59407140 CCTCCTGGAGCCCTTGCTGTAGG + Intergenic
1150280506 17:63927496-63927518 GCAGGTGGAGACCCTGCTTGGGG + Intergenic
1150764537 17:67993167-67993189 CCGGCTGGTGACCCTGCTGGTGG - Exonic
1151943616 17:77307389-77307411 CCTGCTGGAGATGATCCTTGTGG + Intronic
1152392271 17:80009980-80010002 CCTGCTGAAGCCCTTGCCTCAGG + Intronic
1152745495 17:82036881-82036903 CCTGCTGCAGCCCTTCCTGGAGG - Exonic
1152803702 17:82344558-82344580 CCTCCTGGAGACCCTCCTGGTGG + Intergenic
1153604555 18:6818692-6818714 CTTGCTGCAGAAATTGCTTGGGG + Intronic
1156076319 18:33282980-33283002 CCTGCTGGAGACTCTGTGTGTGG - Intronic
1156445452 18:37233444-37233466 CCTGCTGGAGGCACTGCCTGAGG - Intergenic
1159849839 18:73514736-73514758 CCAGCTGTAGAACCTGCTTGTGG - Intergenic
1161129489 19:2579617-2579639 CCTGCTGGTCACCTTCCTCGGGG + Intronic
1162718256 19:12647284-12647306 CCTGCAGGAGACCACGCTGGTGG - Exonic
1163126594 19:15247516-15247538 CCTGGAGGAGAGCTGGCTTGTGG + Intronic
1163389703 19:17022853-17022875 CCTGCCGGTTACCTGGCTTGTGG - Intronic
1163451196 19:17378476-17378498 CCTGCTGGAGGCACTGCTGGGGG + Intergenic
1165230126 19:34381617-34381639 CCTGCTGCATACCTAGCTTGGGG + Intronic
1166141380 19:40807149-40807171 CCTGCTGCAGATCTTCCCTGAGG + Exonic
1166323844 19:42037080-42037102 ACTGCTAGATACCTTTCTTGAGG - Intronic
1166433180 19:42743235-42743257 CCTGCTGGAGCTCTTGTTTTGGG + Intronic
1166436278 19:42768462-42768484 CCTGCTGGAGCTCTTGTTTTGGG + Intronic
1166449141 19:42882438-42882460 CCTGCTGGAGCTCTTGTTTTGGG + Intronic
1166456027 19:42939951-42939973 CCTGCTGGAGCTCTTGTTTTGGG + Intronic
1166471955 19:43085420-43085442 CCTGCTGGAGCTCTTGTTTTGGG + Intronic
1166483093 19:43189246-43189268 CCTGCTGGAGCTCTTGTTTTGGG + Intronic
1166485562 19:43208343-43208365 CCTGCTGGAGCTCTTGTTTTGGG + Intergenic
1166794268 19:45416882-45416904 CCTGCTGGGGATCTTTCTGGAGG + Exonic
1167379010 19:49127996-49128018 CCTGCTGGAGACGCTGCGCGAGG + Exonic
1168274017 19:55266149-55266171 CCTGCTGCAGAACCTGCTGGTGG - Exonic
926434604 2:12825110-12825132 CCTGCTGGAGCCTTTCCTAGGGG + Intergenic
926660029 2:15454809-15454831 CCTGGAGAAGACCTTGCTTATGG - Intronic
929765839 2:44843509-44843531 CTTGCTGGAGACCTTTCTGTAGG + Intergenic
931447318 2:62337581-62337603 AATGATGGAGGCCTTGCTTGGGG - Intergenic
932443418 2:71754046-71754068 CCTCCTGAAGAACCTGCTTGAGG - Intergenic
934913817 2:98281823-98281845 CCTGCTGGTGTCATTGCTCGTGG + Intronic
938994144 2:136659529-136659551 CCTGCTGGAGAGCCTGCCAGTGG - Intergenic
941080447 2:161054844-161054866 CCTGCTGGTTACCTGGCTTCAGG - Intergenic
941903002 2:170695471-170695493 GCAGCTGGGGACCCTGCTTGGGG + Intergenic
945408155 2:209476166-209476188 CCTTCTCGAGACCATGATTGTGG + Intronic
945663847 2:212717972-212717994 CCTTCTGGAGATCTTACTTAAGG + Intergenic
947811187 2:233004797-233004819 CCTGCTGGGGGCCTTTCTTCGGG + Intronic
948378211 2:237536268-237536290 CCTGCTGGACACATGGCATGTGG - Intronic
948653835 2:239464807-239464829 CCAGTTGGAGACCTCCCTTGCGG + Intergenic
948725542 2:239931555-239931577 GCAGGTGGAGACCCTGCTTGGGG - Intronic
948868053 2:240785250-240785272 CCTGCTGGAGTCCTGGCAGGAGG - Intronic
948961953 2:241346169-241346191 CCTCCTGGAGATCCTGCATGTGG - Exonic
1170836494 20:19889088-19889110 CCTTCTGTTGACCTTGCCTGGGG + Intronic
1173191790 20:40882525-40882547 GATCCTGGAGTCCTTGCTTGGGG - Intergenic
1173650442 20:44660447-44660469 CCTGCTGGAGATCCTGGTTTGGG + Intergenic
1174199071 20:48794474-48794496 CCAGCAGGAGCCTTTGCTTGGGG + Intronic
1175824702 20:61930594-61930616 CCTCCTGCAGACCTGGCCTGCGG + Intronic
1177066680 21:16445692-16445714 CCTCCTGGAGGACTTGCCTGAGG - Intergenic
1178291695 21:31373974-31373996 GCTTCTGGTGACCTTGGTTGGGG - Intronic
1179190054 21:39115867-39115889 CCTGCTGGAGTCCAGGGTTGGGG - Intergenic
1181015387 22:20065784-20065806 CCAGCTGGAGACCATGCCTCTGG + Exonic
1181175342 22:21031982-21032004 CCTGCTGGAGAGCTGGAATGGGG + Intronic
1181422469 22:22811426-22811448 CCTTCTAGAAACCTGGCTTGGGG - Intronic
1182024669 22:27108813-27108835 CCTGGCGGAGACTATGCTTGTGG - Intergenic
1182303002 22:29349241-29349263 GCTGCTGGAGAGCTTCCTCGAGG - Exonic
1182446652 22:30393598-30393620 CTTGCTGGGGACTTTGCTTAGGG - Intronic
1182800809 22:33030303-33030325 CCTTCTGGATGCCTTGCTTAGGG + Intronic
1183395685 22:37569500-37569522 CCTGCTGGGGGCCTTGATGGGGG - Intergenic
949928160 3:9058220-9058242 CCTCCTGGAGCCCGGGCTTGGGG - Intronic
952279696 3:31911087-31911109 CCTGCTTCAGACCCTGTTTGAGG + Intronic
953301426 3:41780557-41780579 CCTGCTGGAGTCCTTGCAGCAGG + Intronic
962892088 3:139680825-139680847 CATTCTGGAAAGCTTGCTTGTGG + Intergenic
964292485 3:155196694-155196716 CCAGCTGGAGACATTGCTGAGGG + Intergenic
964369003 3:155979917-155979939 CCTGCTGGAGGCTCTTCTTGAGG + Intergenic
968273478 3:197422630-197422652 ACTGCTGGAGCCTTTGGTTGGGG + Intergenic
970834961 4:20392874-20392896 CCTCCTGAAGAACCTGCTTGAGG + Intronic
971993420 4:33931806-33931828 TCTGCTGGAGAACTTGCTGTGGG + Intergenic
973980900 4:56307459-56307481 CATGCTGGAGAACCTGGTTGTGG + Intronic
974865077 4:67570106-67570128 CCTCCTGAAGAACATGCTTGAGG + Intronic
975033770 4:69656972-69656994 CCTGCTTGAAAACTTGCCTGAGG - Intergenic
980347933 4:131647529-131647551 CTTGCTGGAGACCCTGCATCTGG - Intergenic
980424637 4:132611142-132611164 CCTCCTGAAGGACTTGCTTGAGG + Intergenic
982261037 4:153494664-153494686 CCTGTTGCAGACCTTGCCTATGG + Intronic
983944129 4:173567364-173567386 CCTGCTCTAGACCATGCTTTGGG + Intergenic
985893422 5:2734129-2734151 CATGTTGGATACATTGCTTGTGG - Intergenic
985939898 5:3127020-3127042 CCTGGAGGAGACCTTGCCTTGGG + Intergenic
987766399 5:22236925-22236947 CCTCCTGAAGGCCCTGCTTGAGG + Intronic
988113670 5:26855429-26855451 CCTGCTGGGGACTTTGTATGAGG + Intergenic
989146871 5:38258307-38258329 CCCGCTGGTGACCTAGATTGGGG - Intergenic
989982942 5:50665804-50665826 CCTGCTGGAGACCTCTCCTAGGG + Intergenic
992220354 5:74565962-74565984 AATTCTGGAGACCTTGGTTGAGG - Intergenic
993509291 5:88751705-88751727 CATGCAGGAGACCTAGCTCGGGG + Intronic
997354190 5:133251864-133251886 GCTGTGGGAGGCCTTGCTTGGGG + Intronic
997749497 5:136330725-136330747 CCTGCTGGTGACTTAGCGTGGGG - Intronic
999028901 5:148268016-148268038 CCTGCTCCAGACCTTGGTTGTGG - Intergenic
1000446144 5:161323450-161323472 CTTGATGGAGACATTGCTTCTGG + Intronic
1000704798 5:164497431-164497453 CCTGCTGGCGATATTGCATGTGG - Intergenic
1003482666 6:6547313-6547335 CCTGCTGCAGAGCTGGCTTCAGG - Intergenic
1004566302 6:16801247-16801269 CCTGCTGGAGCCCCTTCTGGTGG - Intergenic
1007088097 6:39164778-39164800 CCTCATGGAATCCTTGCTTGAGG - Intergenic
1008135827 6:47775648-47775670 CCCTCTGGAGACCTGGATTGGGG + Intergenic
1016040524 6:139427761-139427783 CCTGCTGGAGAACTTGCCAGGGG + Intergenic
1017512784 6:155129465-155129487 ACCTCTGGAGACCTTGCATGTGG - Exonic
1018706519 6:166467601-166467623 CCAGCTGGAGCCAGTGCTTGGGG + Intronic
1019481225 7:1267654-1267676 CCTGCAGGAGACCGAGCTGGGGG + Intergenic
1019606779 7:1913956-1913978 CCTGCTGGACGCCATGCTGGGGG + Intronic
1019896708 7:3988727-3988749 CGTGCTGGAGAGCTTCTTTGTGG - Intronic
1020117650 7:5485097-5485119 CCTGCTTCATTCCTTGCTTGTGG - Intronic
1021840626 7:24718986-24719008 AGTCCTGGAGACCTTGGTTGGGG - Intronic
1023629788 7:42152720-42152742 GCTGCTGTTGACCTTGCTTGGGG - Intronic
1024725994 7:52195934-52195956 TCTTCTGGAGACCTTGCTTAAGG + Intergenic
1027363691 7:77434826-77434848 CCAGCTGGAAACCATGCTTGTGG + Intergenic
1028426226 7:90692622-90692644 CCTGGTGGAGACTATGCTGGCGG + Intronic
1028580531 7:92404775-92404797 CCTGCTGGAGACTTTCCATCTGG - Intergenic
1030376285 7:108756374-108756396 CCTGCTGAAGACTTTGTGTGTGG - Intergenic
1034198593 7:149266601-149266623 CGTGCTGGGGACCTTGCTGCAGG + Exonic
1035557684 8:578986-579008 CTTGCTGGAGTCTCTGCTTGGGG - Intergenic
1037104549 8:15090646-15090668 CCTGCTGGAGACCTTCCAGATGG - Intronic
1037134028 8:15440869-15440891 CCAGATAGAGAGCTTGCTTGAGG + Intronic
1037167935 8:15853692-15853714 CCTGCTGGAGTCCTTGCCTCAGG + Intergenic
1039525334 8:38209658-38209680 CCTTTTCAAGACCTTGCTTGAGG + Intronic
1045703669 8:104896153-104896175 CCTGCTGGAGCCCCTGCTATGGG + Intronic
1049036378 8:140079470-140079492 TCTGCTGGAGCCGCTGCTTGTGG - Intronic
1049724239 8:144138114-144138136 CCTGCACGAGACATTGCTGGCGG + Exonic
1053062342 9:35042263-35042285 GCTGCTGGAGGACCTGCTTGGGG + Exonic
1058873278 9:109220704-109220726 CCTCCTGGAGACTTTGCTCAAGG + Intronic
1061576806 9:131512504-131512526 ACAGCTAGAGACCTTGTTTGGGG - Intronic
1187458596 X:19465400-19465422 GCAGCTGGAGACCATCCTTGTGG + Intronic
1189558074 X:42165858-42165880 CCTGCTGGTGACTGTGCATGTGG + Intergenic
1191803620 X:65108599-65108621 CCTCCTGGAGGACTTGCCTGAGG + Intergenic
1192087297 X:68113442-68113464 CTAGTTGGAGACCTTGCTAGAGG - Intronic
1193300428 X:79881988-79882010 TCTGCTGGCAACTTTGCTTGTGG - Intergenic
1193468638 X:81874683-81874705 CCAGCTGGGGAACCTGCTTGTGG - Intergenic
1194610401 X:96036077-96036099 CCTTATGGAGACCGGGCTTGGGG + Intergenic
1196468218 X:115994017-115994039 CCTGCTGGAGACTGTGCTTATGG - Intergenic
1197755730 X:129993042-129993064 CCTGCTGAAGACCAAGATTGAGG + Intronic
1199642076 X:149872113-149872135 CCTGCTGGAGACTGTGTGTGTGG - Intergenic