ID: 1128804282

View in Genome Browser
Species Human (GRCh38)
Location 15:70519077-70519099
Sequence CATTCTAAGGGGAAAAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128804282_1128804291 28 Left 1128804282 15:70519077-70519099 CCTGCCTTTTTCCCCTTAGAATG No data
Right 1128804291 15:70519128-70519150 TCATGCACATAGACCCCCAGTGG No data
1128804282_1128804287 -7 Left 1128804282 15:70519077-70519099 CCTGCCTTTTTCCCCTTAGAATG No data
Right 1128804287 15:70519093-70519115 TAGAATGAGATCTTCCCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128804282 Original CRISPR CATTCTAAGGGGAAAAAGGC AGG (reversed) Intergenic
No off target data available for this crispr