ID: 1128805245

View in Genome Browser
Species Human (GRCh38)
Location 15:70526137-70526159
Sequence AGGCAGAAGCAGAATGAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128805245_1128805250 0 Left 1128805245 15:70526137-70526159 CCCAACTCATTCTGCTTCTGCCT No data
Right 1128805250 15:70526160-70526182 TCTCCTCGTGGGTCCTAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128805245 Original CRISPR AGGCAGAAGCAGAATGAGTT GGG (reversed) Intergenic
No off target data available for this crispr