ID: 1128805707

View in Genome Browser
Species Human (GRCh38)
Location 15:70529505-70529527
Sequence CCGTTCTAGTCTAAACCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128805707_1128805710 14 Left 1128805707 15:70529505-70529527 CCTCAGGGTTTAGACTAGAACGG No data
Right 1128805710 15:70529542-70529564 TCGAATAACACACATTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128805707 Original CRISPR CCGTTCTAGTCTAAACCCTG AGG (reversed) Intergenic
No off target data available for this crispr