ID: 1128805855

View in Genome Browser
Species Human (GRCh38)
Location 15:70530805-70530827
Sequence ACTGAATGGAAACTTTAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128805855_1128805862 10 Left 1128805855 15:70530805-70530827 CCAGCTTAAAGTTTCCATTCAGT No data
Right 1128805862 15:70530838-70530860 CACCTAGTGATAAACAGGTGAGG No data
1128805855_1128805864 19 Left 1128805855 15:70530805-70530827 CCAGCTTAAAGTTTCCATTCAGT No data
Right 1128805864 15:70530847-70530869 ATAAACAGGTGAGGAAACTGTGG No data
1128805855_1128805861 5 Left 1128805855 15:70530805-70530827 CCAGCTTAAAGTTTCCATTCAGT No data
Right 1128805861 15:70530833-70530855 CTGGACACCTAGTGATAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128805855 Original CRISPR ACTGAATGGAAACTTTAAGC TGG (reversed) Intergenic
No off target data available for this crispr