ID: 1128806639

View in Genome Browser
Species Human (GRCh38)
Location 15:70536056-70536078
Sequence TCACAGCAATGGTGTGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128806636_1128806639 21 Left 1128806636 15:70536012-70536034 CCAGACTCTGCGGGGCATTTGAC No data
Right 1128806639 15:70536056-70536078 TCACAGCAATGGTGTGATGCAGG No data
1128806635_1128806639 28 Left 1128806635 15:70536005-70536027 CCATGTACCAGACTCTGCGGGGC No data
Right 1128806639 15:70536056-70536078 TCACAGCAATGGTGTGATGCAGG No data
1128806637_1128806639 -10 Left 1128806637 15:70536043-70536065 CCTCTTTTAATTCTCACAGCAAT No data
Right 1128806639 15:70536056-70536078 TCACAGCAATGGTGTGATGCAGG No data
1128806633_1128806639 29 Left 1128806633 15:70536004-70536026 CCCATGTACCAGACTCTGCGGGG No data
Right 1128806639 15:70536056-70536078 TCACAGCAATGGTGTGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128806639 Original CRISPR TCACAGCAATGGTGTGATGC AGG Intergenic