ID: 1128809336

View in Genome Browser
Species Human (GRCh38)
Location 15:70559347-70559369
Sequence TGCAGGAAATGAGAGGCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128809332_1128809336 -5 Left 1128809332 15:70559329-70559351 CCACAGCAAGCCTGCGGGTGCAG No data
Right 1128809336 15:70559347-70559369 TGCAGGAAATGAGAGGCCACAGG No data
1128809327_1128809336 10 Left 1128809327 15:70559314-70559336 CCTGTGTTCCGTCCTCCACAGCA No data
Right 1128809336 15:70559347-70559369 TGCAGGAAATGAGAGGCCACAGG No data
1128809326_1128809336 18 Left 1128809326 15:70559306-70559328 CCAGGCTGCCTGTGTTCCGTCCT No data
Right 1128809336 15:70559347-70559369 TGCAGGAAATGAGAGGCCACAGG No data
1128809331_1128809336 -2 Left 1128809331 15:70559326-70559348 CCTCCACAGCAAGCCTGCGGGTG No data
Right 1128809336 15:70559347-70559369 TGCAGGAAATGAGAGGCCACAGG No data
1128809328_1128809336 2 Left 1128809328 15:70559322-70559344 CCGTCCTCCACAGCAAGCCTGCG No data
Right 1128809336 15:70559347-70559369 TGCAGGAAATGAGAGGCCACAGG No data
1128809325_1128809336 23 Left 1128809325 15:70559301-70559323 CCAGTCCAGGCTGCCTGTGTTCC No data
Right 1128809336 15:70559347-70559369 TGCAGGAAATGAGAGGCCACAGG No data
1128809322_1128809336 30 Left 1128809322 15:70559294-70559316 CCACCCTCCAGTCCAGGCTGCCT No data
Right 1128809336 15:70559347-70559369 TGCAGGAAATGAGAGGCCACAGG No data
1128809324_1128809336 26 Left 1128809324 15:70559298-70559320 CCTCCAGTCCAGGCTGCCTGTGT No data
Right 1128809336 15:70559347-70559369 TGCAGGAAATGAGAGGCCACAGG No data
1128809323_1128809336 27 Left 1128809323 15:70559297-70559319 CCCTCCAGTCCAGGCTGCCTGTG No data
Right 1128809336 15:70559347-70559369 TGCAGGAAATGAGAGGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128809336 Original CRISPR TGCAGGAAATGAGAGGCCAC AGG Intergenic
No off target data available for this crispr