ID: 1128809596

View in Genome Browser
Species Human (GRCh38)
Location 15:70561234-70561256
Sequence GGAGCCATGAAAGCTAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128809592_1128809596 7 Left 1128809592 15:70561204-70561226 CCAGAGGGCCACCTTTTCTCATC No data
Right 1128809596 15:70561234-70561256 GGAGCCATGAAAGCTAGTGATGG No data
1128809593_1128809596 -1 Left 1128809593 15:70561212-70561234 CCACCTTTTCTCATCACTCAGAG No data
Right 1128809596 15:70561234-70561256 GGAGCCATGAAAGCTAGTGATGG No data
1128809595_1128809596 -4 Left 1128809595 15:70561215-70561237 CCTTTTCTCATCACTCAGAGGAG No data
Right 1128809596 15:70561234-70561256 GGAGCCATGAAAGCTAGTGATGG No data
1128809591_1128809596 8 Left 1128809591 15:70561203-70561225 CCCAGAGGGCCACCTTTTCTCAT No data
Right 1128809596 15:70561234-70561256 GGAGCCATGAAAGCTAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128809596 Original CRISPR GGAGCCATGAAAGCTAGTGA TGG Intergenic
No off target data available for this crispr