ID: 1128811410

View in Genome Browser
Species Human (GRCh38)
Location 15:70575555-70575577
Sequence AAGTGGAAACAGATGGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128811410_1128811418 28 Left 1128811410 15:70575555-70575577 CCACCATCCATCTGTTTCCACTT No data
Right 1128811418 15:70575606-70575628 TGGAAATGTGTTTTTACTTGAGG No data
1128811410_1128811416 -3 Left 1128811410 15:70575555-70575577 CCACCATCCATCTGTTTCCACTT No data
Right 1128811416 15:70575575-70575597 CTTTCTCAAGGGCTGTAGCAAGG No data
1128811410_1128811417 8 Left 1128811410 15:70575555-70575577 CCACCATCCATCTGTTTCCACTT No data
Right 1128811417 15:70575586-70575608 GCTGTAGCAAGGAATAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128811410 Original CRISPR AAGTGGAAACAGATGGATGG TGG (reversed) Intergenic
No off target data available for this crispr