ID: 1128811417

View in Genome Browser
Species Human (GRCh38)
Location 15:70575586-70575608
Sequence GCTGTAGCAAGGAATAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128811412_1128811417 1 Left 1128811412 15:70575562-70575584 CCATCTGTTTCCACTTTCTCAAG No data
Right 1128811417 15:70575586-70575608 GCTGTAGCAAGGAATAGAGCTGG No data
1128811409_1128811417 26 Left 1128811409 15:70575537-70575559 CCTCTCTCATTATCAAAGCCACC No data
Right 1128811417 15:70575586-70575608 GCTGTAGCAAGGAATAGAGCTGG No data
1128811415_1128811417 -9 Left 1128811415 15:70575572-70575594 CCACTTTCTCAAGGGCTGTAGCA No data
Right 1128811417 15:70575586-70575608 GCTGTAGCAAGGAATAGAGCTGG No data
1128811411_1128811417 5 Left 1128811411 15:70575558-70575580 CCATCCATCTGTTTCCACTTTCT No data
Right 1128811417 15:70575586-70575608 GCTGTAGCAAGGAATAGAGCTGG No data
1128811410_1128811417 8 Left 1128811410 15:70575555-70575577 CCACCATCCATCTGTTTCCACTT No data
Right 1128811417 15:70575586-70575608 GCTGTAGCAAGGAATAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128811417 Original CRISPR GCTGTAGCAAGGAATAGAGC TGG Intergenic
No off target data available for this crispr