ID: 1128811638

View in Genome Browser
Species Human (GRCh38)
Location 15:70577418-70577440
Sequence ATCCTCAGTCTTGCAAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128811638 Original CRISPR ATCCTCAGTCTTGCAAAAGG AGG (reversed) Intergenic