ID: 1128813543

View in Genome Browser
Species Human (GRCh38)
Location 15:70588697-70588719
Sequence GGAAGGAGACTATTTTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128813543_1128813550 21 Left 1128813543 15:70588697-70588719 CCCAGCTAAAATAGTCTCCTTCC No data
Right 1128813550 15:70588741-70588763 GTGGCCACGTGACCCATATGTGG No data
1128813543_1128813548 2 Left 1128813543 15:70588697-70588719 CCCAGCTAAAATAGTCTCCTTCC No data
Right 1128813548 15:70588722-70588744 GATTCTCTTACCACGAAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128813543 Original CRISPR GGAAGGAGACTATTTTAGCT GGG (reversed) Intergenic
No off target data available for this crispr