ID: 1128818834

View in Genome Browser
Species Human (GRCh38)
Location 15:70634230-70634252
Sequence CAAACTTCCATTTGTTTATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128818834_1128818844 30 Left 1128818834 15:70634230-70634252 CCTGATAAACAAATGGAAGTTTG No data
Right 1128818844 15:70634283-70634305 ATGGAGGCATTAAATGTGCCTGG No data
1128818834_1128818836 -6 Left 1128818834 15:70634230-70634252 CCTGATAAACAAATGGAAGTTTG No data
Right 1128818836 15:70634247-70634269 AGTTTGGCAGAAACACAAAGTGG No data
1128818834_1128818841 7 Left 1128818834 15:70634230-70634252 CCTGATAAACAAATGGAAGTTTG No data
Right 1128818841 15:70634260-70634282 CACAAAGTGGGGATGAAGGGCGG No data
1128818834_1128818837 -5 Left 1128818834 15:70634230-70634252 CCTGATAAACAAATGGAAGTTTG No data
Right 1128818837 15:70634248-70634270 GTTTGGCAGAAACACAAAGTGGG No data
1128818834_1128818838 -4 Left 1128818834 15:70634230-70634252 CCTGATAAACAAATGGAAGTTTG No data
Right 1128818838 15:70634249-70634271 TTTGGCAGAAACACAAAGTGGGG No data
1128818834_1128818840 4 Left 1128818834 15:70634230-70634252 CCTGATAAACAAATGGAAGTTTG No data
Right 1128818840 15:70634257-70634279 AAACACAAAGTGGGGATGAAGGG No data
1128818834_1128818839 3 Left 1128818834 15:70634230-70634252 CCTGATAAACAAATGGAAGTTTG No data
Right 1128818839 15:70634256-70634278 GAAACACAAAGTGGGGATGAAGG No data
1128818834_1128818842 11 Left 1128818834 15:70634230-70634252 CCTGATAAACAAATGGAAGTTTG No data
Right 1128818842 15:70634264-70634286 AAGTGGGGATGAAGGGCGGATGG No data
1128818834_1128818843 14 Left 1128818834 15:70634230-70634252 CCTGATAAACAAATGGAAGTTTG No data
Right 1128818843 15:70634267-70634289 TGGGGATGAAGGGCGGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128818834 Original CRISPR CAAACTTCCATTTGTTTATC AGG (reversed) Intergenic
No off target data available for this crispr