ID: 1128818842

View in Genome Browser
Species Human (GRCh38)
Location 15:70634264-70634286
Sequence AAGTGGGGATGAAGGGCGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128818834_1128818842 11 Left 1128818834 15:70634230-70634252 CCTGATAAACAAATGGAAGTTTG No data
Right 1128818842 15:70634264-70634286 AAGTGGGGATGAAGGGCGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128818842 Original CRISPR AAGTGGGGATGAAGGGCGGA TGG Intergenic
No off target data available for this crispr