ID: 1128818857

View in Genome Browser
Species Human (GRCh38)
Location 15:70634328-70634350
Sequence AAGGAGAAGCAGCTGGAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128818848_1128818857 4 Left 1128818848 15:70634301-70634323 CCTGGTGTGTTGGGGACACCTCC No data
Right 1128818857 15:70634328-70634350 AAGGAGAAGCAGCTGGAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128818857 Original CRISPR AAGGAGAAGCAGCTGGAGGG GGG Intergenic
No off target data available for this crispr