ID: 1128819666

View in Genome Browser
Species Human (GRCh38)
Location 15:70640357-70640379
Sequence CTTAGGTTGTTCACTGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128819666_1128819669 7 Left 1128819666 15:70640357-70640379 CCAGTAGCAGTGAACAACCTAAG No data
Right 1128819669 15:70640387-70640409 ACAGCACCTCGTGGAGAAGCTGG No data
1128819666_1128819668 -2 Left 1128819666 15:70640357-70640379 CCAGTAGCAGTGAACAACCTAAG No data
Right 1128819668 15:70640378-70640400 AGATATCACACAGCACCTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128819666 Original CRISPR CTTAGGTTGTTCACTGCTAC TGG (reversed) Intergenic