ID: 1128820042

View in Genome Browser
Species Human (GRCh38)
Location 15:70643579-70643601
Sequence CAATTAGTGTATAAGCCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128820037_1128820042 -1 Left 1128820037 15:70643557-70643579 CCCACTTCTCCAGCCTCCTTTGC No data
Right 1128820042 15:70643579-70643601 CAATTAGTGTATAAGCCACATGG No data
1128820039_1128820042 -10 Left 1128820039 15:70643566-70643588 CCAGCCTCCTTTGCAATTAGTGT No data
Right 1128820042 15:70643579-70643601 CAATTAGTGTATAAGCCACATGG No data
1128820035_1128820042 6 Left 1128820035 15:70643550-70643572 CCCAGAACCCACTTCTCCAGCCT No data
Right 1128820042 15:70643579-70643601 CAATTAGTGTATAAGCCACATGG No data
1128820038_1128820042 -2 Left 1128820038 15:70643558-70643580 CCACTTCTCCAGCCTCCTTTGCA No data
Right 1128820042 15:70643579-70643601 CAATTAGTGTATAAGCCACATGG No data
1128820036_1128820042 5 Left 1128820036 15:70643551-70643573 CCAGAACCCACTTCTCCAGCCTC No data
Right 1128820042 15:70643579-70643601 CAATTAGTGTATAAGCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128820042 Original CRISPR CAATTAGTGTATAAGCCACA TGG Intergenic
No off target data available for this crispr