ID: 1128820898

View in Genome Browser
Species Human (GRCh38)
Location 15:70652284-70652306
Sequence CTGTGTTTCTAGTAGTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128820898_1128820900 20 Left 1128820898 15:70652284-70652306 CCTGGAAACTACTAGAAACACAG No data
Right 1128820900 15:70652327-70652349 ACAAAGGACATGTACCTACTTGG No data
1128820898_1128820899 4 Left 1128820898 15:70652284-70652306 CCTGGAAACTACTAGAAACACAG No data
Right 1128820899 15:70652311-70652333 TCTAAGTGAAATATCAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128820898 Original CRISPR CTGTGTTTCTAGTAGTTTCC AGG (reversed) Intergenic
No off target data available for this crispr