ID: 1128821896

View in Genome Browser
Species Human (GRCh38)
Location 15:70664140-70664162
Sequence ATTTAGAAGCTAATGTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 257}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128821896_1128821900 3 Left 1128821896 15:70664140-70664162 CCTTCCAACATTAGCTTCTAAAT 0: 1
1: 0
2: 0
3: 15
4: 257
Right 1128821900 15:70664166-70664188 GGCACTTATCCTTCTATATAAGG 0: 1
1: 0
2: 1
3: 8
4: 133
1128821896_1128821902 17 Left 1128821896 15:70664140-70664162 CCTTCCAACATTAGCTTCTAAAT 0: 1
1: 0
2: 0
3: 15
4: 257
Right 1128821902 15:70664180-70664202 TATATAAGGTATAAAACCATAGG 0: 1
1: 1
2: 0
3: 17
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128821896 Original CRISPR ATTTAGAAGCTAATGTTGGA AGG (reversed) Intronic
901811742 1:11771345-11771367 ATTTAAAAGCTATTGCTGGGGGG - Intronic
904420558 1:30388325-30388347 TTTCACAAGCTAATGTTGGTTGG - Intergenic
907143551 1:52211284-52211306 ATTAAGAAGATAGTGTGGGATGG - Intronic
907837134 1:58120659-58120681 ATTAGGCAGCTAAAGTTGGAAGG - Intronic
908534325 1:65065153-65065175 GTTCTGAAGCTAAAGTTGGAAGG + Intergenic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
909571771 1:77120516-77120538 ATTTAAAAGCAAATTTTGGCCGG - Intronic
909966980 1:81925252-81925274 ATTAATAAGTTAATGTTGGAGGG - Intronic
910807501 1:91203530-91203552 ATTTGGAGGCCAATGTTCGATGG - Intergenic
910907813 1:92200098-92200120 TTATAAAACCTAATGTTGGATGG - Intergenic
911376653 1:97059651-97059673 TTTTATAAGCTAATATTTGAAGG + Intergenic
911403684 1:97408857-97408879 ATTTGGAGTCTGATGTTGGAGGG - Intronic
918213835 1:182375697-182375719 CTTTATAAGCTAATCTTGGAAGG - Intergenic
918743294 1:188164727-188164749 ATTTATAAACTAATATTGCATGG + Intergenic
922094443 1:222430924-222430946 AGTTAGGAGCTCATGTTTGAGGG + Intergenic
923753056 1:236764817-236764839 ATTTAGAAGTGAATGATGGATGG + Intergenic
923945701 1:238884765-238884787 ATTAAGAAGCCACTGTTGCAAGG - Intergenic
1063576153 10:7263605-7263627 ATTTAGCAGTTAATGTTTGTGGG - Intronic
1064549510 10:16484641-16484663 ATTTTAAAGCTAATGGTGGAGGG + Exonic
1065142675 10:22734529-22734551 ATTTAGAATATAATTTAGGAAGG + Intergenic
1068397621 10:56484757-56484779 TTTTATAATCTAATCTTGGAAGG - Intergenic
1069027647 10:63561315-63561337 ATTTAGAAGTTTATGGAGGAAGG + Intronic
1071463138 10:85917393-85917415 ATTTAGAGGGTAAATTTGGAGGG - Intronic
1072158732 10:92747065-92747087 CTTTAGAAACTTATTTTGGAAGG + Intergenic
1072210866 10:93246082-93246104 ATTTCGAAGGGAATGTTTGAGGG - Intergenic
1073160646 10:101391750-101391772 ATATAGTAGCTAATGATGGCAGG - Intronic
1073811799 10:107160486-107160508 ATTTATTCACTAATGTTGGATGG + Intronic
1078835303 11:15022654-15022676 ATTTAGAATATGATCTTGGAAGG + Intronic
1078929941 11:15905304-15905326 ATTTCGAGGCAAGTGTTGGAGGG + Intergenic
1078947743 11:16089723-16089745 ATTGAGAAGCTACAGTTGGATGG - Intronic
1080954228 11:37074289-37074311 ATTTAGAAACCATTGTTGGCTGG + Intergenic
1081987103 11:47313608-47313630 ATTTAGAAAATACTGTTGGCTGG - Intronic
1082230625 11:49761628-49761650 GTTTAGAGGCTAATGTAGTAAGG - Intergenic
1085845644 11:80061509-80061531 ATATAGAAGCTAATATAGAATGG - Intergenic
1085955465 11:81388355-81388377 ATTTGAAATCTGATGTTGGAGGG + Intergenic
1086619426 11:88867345-88867367 GTTTAGAGGCTAATGTAGTAAGG + Intronic
1087110068 11:94456002-94456024 CTTGAGAGGCTAAGGTTGGAGGG - Intronic
1087302923 11:96456652-96456674 ATTTAGAAGTTTATTTTGCAAGG - Intronic
1087888637 11:103510657-103510679 ATTTAAAAGCCAATGTTAAAAGG + Intergenic
1088875938 11:113936249-113936271 ATTTAGGAACTCGTGTTGGATGG + Intronic
1089934890 11:122354059-122354081 ATTTATTAGCTAATGATGAAAGG + Intergenic
1090167810 11:124570048-124570070 ATTAAAAGGCTAATCTTGGACGG - Exonic
1090898946 11:131008205-131008227 ATTTAAAAGCCAACTTTGGAAGG - Intergenic
1090987372 11:131780763-131780785 CTTTAGAATCTAATGTGAGAGGG + Intronic
1094782478 12:33807499-33807521 ATTCAGAATCCAATGTTTGAGGG + Intergenic
1095543369 12:43337669-43337691 ATTTAGAACCTAAAGTTGATGGG + Intergenic
1095587598 12:43865291-43865313 AGTTAGAAGGTAAAGTTAGAAGG - Intronic
1097108886 12:56643115-56643137 ATTTGAAAGCTAATTTTGGGAGG - Intronic
1097160344 12:57041933-57041955 ATTTAGAAGCTATTACTGAAAGG - Intronic
1098276447 12:68816651-68816673 ACTTAGAAGCTACTTTTGGCTGG - Intronic
1098855003 12:75642897-75642919 AATTAGTTGCTAATCTTGGATGG - Intergenic
1099725914 12:86427722-86427744 ATTTAAAAGCTAATATAGGCTGG + Intronic
1101173728 12:102126837-102126859 ATCTTGAAAATAATGTTGGATGG - Intronic
1103372381 12:120429525-120429547 ACTTAGAAGTTAATGGGGGAGGG + Intergenic
1103832634 12:123792332-123792354 ATTTAGAGGCTATTGTTGATAGG - Intronic
1104827445 12:131723412-131723434 ATTTTAAAGCTTATTTTGGAAGG + Intronic
1104948256 12:132427133-132427155 ACTGAGAAGCTGATGTTGGAAGG + Intergenic
1107322200 13:39201770-39201792 ATTGAGAAGCTATTTTTTGACGG - Intergenic
1109077864 13:57861121-57861143 ATCATGAAGCTAATGCTGGAAGG - Intergenic
1109161384 13:58979125-58979147 ATTTAAAAAATAATGGTGGATGG + Intergenic
1109286704 13:60417917-60417939 ATTTAGAAGGTAAAATTGGCAGG - Intronic
1109515869 13:63441838-63441860 ATTTAGAGTCTGATGTTCGAGGG - Intergenic
1110801408 13:79700813-79700835 TTCTAGAAGCTAATATGGGAGGG + Intergenic
1112523127 13:100116524-100116546 ATTTTGAAGAACATGTTGGAGGG - Intronic
1113827482 13:113267967-113267989 ATTTAGGAGGTAAGCTTGGAGGG + Intergenic
1116417156 14:44692521-44692543 ATTTACATGCTTATGTTAGAAGG - Intergenic
1118547647 14:66910550-66910572 ATTTGAAAGCTAATGTTCTAGGG - Intronic
1119283505 14:73431063-73431085 ATTTGGAGGCTGATGTGGGAGGG - Intronic
1121077151 14:91078431-91078453 TTTTAGAAGCTACTATTTGATGG + Intronic
1125318382 15:38456719-38456741 ATTAAGTAGTTAAGGTTGGATGG + Intronic
1126293901 15:47115322-47115344 ATGTAGAAGATAATGTGTGATGG - Intergenic
1127739050 15:61880177-61880199 AGTTACAAGCAAATTTTGGAAGG + Intronic
1128190209 15:65686096-65686118 ATTTAGATGCCAATGTAGGGAGG + Intronic
1128298992 15:66552320-66552342 ATTTAGAGACTAATGTAGGCAGG + Intronic
1128821896 15:70664140-70664162 ATTTAGAAGCTAATGTTGGAAGG - Intronic
1128846291 15:70898960-70898982 ATTTAGAAGGTCTTGTTGTATGG + Intronic
1129410145 15:75346272-75346294 ATTAAGAAGTTACTGTTGGCTGG + Intergenic
1130713592 15:86309938-86309960 ATTTACAAGCTAATTTTTCAAGG - Intronic
1132712358 16:1274845-1274867 ATTTAAAAGGTATTGGTGGATGG - Intergenic
1135008734 16:18853900-18853922 CTTTAAAAGCAAATGATGGAGGG + Intronic
1135622424 16:23967478-23967500 ATTTAAAAGCTTGTGTGGGAAGG + Intronic
1135782047 16:25312901-25312923 ATTTAGAGTCTGATGTTCGAGGG + Intergenic
1135863530 16:26079397-26079419 ATTTAGGAGCAAATGCTGGCAGG + Intronic
1140088900 16:71820771-71820793 TTTGAGAAGCCAATGTGGGAGGG + Intergenic
1140166333 16:72555702-72555724 ATTTAGAAGCTAAGGCGGGAGGG + Intergenic
1140676179 16:77332494-77332516 ATGTAGAAGATAACCTTGGAAGG - Intronic
1140898425 16:79346588-79346610 ATTTTGAAGGTGATGATGGATGG + Intergenic
1145231183 17:21174509-21174531 ATTGAAAAGCTGATATTGGAAGG - Intronic
1155246979 18:23919982-23920004 ATTTACAAGATTATGTTGGATGG + Intronic
1155563323 18:27104204-27104226 ATTTATAAGATAAGCTTGGAAGG - Intronic
1157390332 18:47296724-47296746 TTTTAGAAGGCAATGATGGATGG + Intergenic
1157939954 18:51917699-51917721 ATTTTGAAGTTGATGTTTGAAGG + Intergenic
1157996932 18:52569541-52569563 ATGTAGAAGCTTGTGTTGAAGGG + Intronic
1158290395 18:55933926-55933948 ATTTAGAAACATCTGTTGGATGG + Intergenic
1158956254 18:62542506-62542528 ATTGAGAAGATAATGTTGAAAGG + Exonic
1159535928 18:69714714-69714736 ATTTAGAAGGAAATTTTGCAAGG + Intronic
1159903880 18:74073295-74073317 ATTTTTAAGTTAATGTTTGAAGG - Intergenic
1160235631 18:77084088-77084110 ATTTGGAACCACATGTTGGAGGG + Intronic
1161473843 19:4473819-4473841 ATGTAGAAGCTGGTTTTGGAGGG + Intronic
1163050612 19:14680621-14680643 ATTTAGAAGCTTATTTTGCTAGG - Intronic
1165592760 19:36985069-36985091 ATTAAGAAGATAATGTGAGATGG - Intronic
926838375 2:17050109-17050131 ACTGAGAAGGTGATGTTGGATGG - Intergenic
927623400 2:24686788-24686810 ATTTAGCAGCTTATATTTGAGGG + Intronic
929119292 2:38470918-38470940 ATTTAGAAGCTATTTTAGTAAGG + Intergenic
929353428 2:40989936-40989958 ATTAAAAAGGTAATGTTGGCAGG + Intergenic
930206793 2:48595074-48595096 ACTTGGAAGCTACTGTAGGAGGG + Intronic
931321216 2:61176513-61176535 TTCTGGAAGATAATGTTGGAAGG + Intergenic
932279940 2:70481814-70481836 ACTTACAAGCTATTGTTGGGAGG - Intronic
933461907 2:82598998-82599020 TTTTAGATGCTAAATTTGGAGGG + Intergenic
933849871 2:86357444-86357466 ATTTAGAAGCCTAGGCTGGAGGG - Intergenic
934592212 2:95564789-95564811 ACTTAGAAGCTGATTTTGGGTGG - Intergenic
936820668 2:116516815-116516837 AGTTAGTAGAGAATGTTGGATGG + Intergenic
937647303 2:124280007-124280029 TTCTAGAAGCAAATGCTGGATGG - Intronic
938014117 2:127853143-127853165 ATTTAGAAGCAAACTTTTGAAGG - Intronic
939806553 2:146781074-146781096 ACTTGGAATCTGATGTTGGAGGG - Intergenic
940978152 2:159970031-159970053 ATTTATAAGTTAATGTTTGAAGG + Intronic
942747161 2:179247531-179247553 ACTTAGGAGCTGATGTGGGAGGG - Intronic
942994209 2:182241399-182241421 GATTATGAGCTAATGTTGGAAGG + Intronic
943636265 2:190310109-190310131 ACTTGGAAGCTGATGTTTGAAGG - Intronic
943752770 2:191526925-191526947 ATTTGGAAGATACTGTTGGCTGG + Intergenic
943928097 2:193813935-193813957 ATTTAGAAGCTGAAGTTCTAAGG - Intergenic
944927218 2:204477635-204477657 ATTAAGCAGCTAAAGCTGGAGGG - Intergenic
946257754 2:218458738-218458760 ATTTATAAGCTTATGTTTAATGG - Intronic
946354373 2:219175978-219176000 ATTGAAAAGCTAATTTTCGAAGG - Intronic
946408945 2:219507055-219507077 ATTTAAATGCTAATGTGGGGGGG - Intergenic
1169640324 20:7743927-7743949 ATTTAGAACTTGATTTTGGAAGG - Intergenic
1171815726 20:29784599-29784621 ATCTAGAAGATATTGTTGAAGGG - Intergenic
1172255656 20:33515050-33515072 ATTAAGAAGTTACTGTTGGCCGG + Intronic
1173117088 20:40254810-40254832 ATTAAGAAGAGAATGTAGGAAGG - Intergenic
1173747734 20:45450592-45450614 ACTTAGAAACTAGTGCTGGATGG + Intergenic
1173861981 20:46289838-46289860 ATTTAGGAGCTGGTGATGGAAGG + Intronic
1174249020 20:49204370-49204392 ATTCAGAATGTAATGTTGAAGGG - Intergenic
1174447346 20:50599093-50599115 ATTTAATAGCTATTGTTGGCTGG + Intronic
1174952102 20:55053424-55053446 ATTTAGAATCTTATCTTGCATGG + Intergenic
1175602755 20:60288288-60288310 AATAAGAAGCTAAAATTGGATGG - Intergenic
1176932158 21:14826542-14826564 ATTTAGGAGATAATTTTAGAGGG - Intergenic
1179820351 21:43933673-43933695 ATGTAGCAGCAAATGTGGGAGGG + Intronic
1185198602 22:49488938-49488960 GTTTAGAAGCTGTTGTTTGAAGG - Intronic
951485600 3:23205356-23205378 ATTTAGAAGATAATGTTTAAAGG + Intronic
951560471 3:23960977-23960999 TTTTAGAAGCTAGTCTTAGAAGG - Intronic
954019717 3:47728608-47728630 TTTTAAAAGTTAATGTTGGCTGG + Intronic
954063276 3:48087095-48087117 ATTTTGAAGCTAAATTTGAAAGG + Intronic
956931108 3:74043990-74044012 AATTAAAAGCTAAAGTTGAAAGG - Intergenic
958173791 3:89969377-89969399 ATTTAGAAGATATTTTTGCAGGG + Intergenic
958622584 3:96580902-96580924 ATTTAGAGTCTGATGTTCGAGGG - Intergenic
960253137 3:115479727-115479749 TTTTAGAAGCTAATGAAGGGGGG - Intergenic
960349937 3:116579740-116579762 ATTTAGAAGCTAACACTGAATGG + Intronic
960495157 3:118364288-118364310 ACTTAGAGTCTGATGTTGGAAGG + Intergenic
960660986 3:120058449-120058471 AATTAGTTGCTAATTTTGGATGG + Intronic
961421453 3:126808286-126808308 TTTTGAAAGCTAATCTTGGAAGG + Intronic
961799381 3:129433475-129433497 ATTTAAAAGCTAATCATGCAAGG - Intronic
962274602 3:134002438-134002460 ATTTAGAAGCTCATGTTCCCTGG + Intronic
963075490 3:141342791-141342813 ACTAAGAAGCTAAAGATGGAAGG + Intronic
963366129 3:144336791-144336813 ATTTAGAGACAAATTTTGGAGGG + Intergenic
965376820 3:167935322-167935344 ATTTAAAACCTAATATTGGCTGG + Intergenic
965523708 3:169695039-169695061 ATTTAGGAGAGAATGTTGTAGGG - Intergenic
967815988 3:193798654-193798676 ATTTAAAAGCTAGTGTTCAATGG + Intergenic
968274695 3:197431465-197431487 AGTTAGAAGATAACATTGGATGG - Intergenic
970143741 4:13011031-13011053 CTTTAGAACCTGCTGTTGGAGGG - Intergenic
970148729 4:13066708-13066730 CTTTAGGAGCTAATGTGAGATGG + Intergenic
971168395 4:24208034-24208056 TTTGAGAAGCTAAGGTGGGAGGG + Intergenic
971443898 4:26721415-26721437 ATTTGGAAGATAAAATTGGAAGG - Intronic
971874452 4:32288342-32288364 AATGAGAAGCTAATATAGGAGGG + Intergenic
972678273 4:41280983-41281005 ATTTAAAAGCTAATTTTCTAAGG + Intergenic
973647680 4:52966446-52966468 ATGTGGAAGGTAATGTGGGAAGG - Intronic
974292614 4:59952387-59952409 ATTTGGAATCTGATGTTCGAGGG + Intergenic
975128209 4:70805699-70805721 ATACAGAAGCTAATATTGCATGG - Intronic
977711905 4:100135953-100135975 GCATTGAAGCTAATGTTGGATGG - Intergenic
977864800 4:102011602-102011624 ACTAATAAGCTCATGTTGGAAGG - Intronic
978219351 4:106252231-106252253 ATAAAGGAGCTAATGCTGGAGGG - Intronic
978636711 4:110817796-110817818 GTTTATAAGCTTAAGTTGGATGG + Intergenic
980029564 4:127811550-127811572 ATTGAGAAGCAAAATTTGGAAGG + Exonic
981276400 4:142902822-142902844 ATTTAGAAGATAATGTGCTAGGG - Intergenic
981321189 4:143393937-143393959 ATGTGGAAGATAATGTTAGAAGG + Intronic
982282521 4:153699487-153699509 CTGTAGTAGCTAATGTTTGAAGG - Intergenic
982356843 4:154479775-154479797 ATTTATAAATTAATGTTTGACGG - Intronic
983758549 4:171374745-171374767 ATTTGTAAGATAATGTTTGATGG - Intergenic
983961069 4:173755310-173755332 ATTTAAAAGTTAATATTGGTAGG + Intergenic
984256346 4:177393879-177393901 ATTTACAAGCTAGTGATGAAAGG - Intergenic
984306836 4:178003657-178003679 ATGTAGAAAATAATGTTGGTGGG - Intergenic
986363563 5:7006276-7006298 ATTTATAAGGTAAAGATGGAGGG + Intergenic
987937451 5:24484927-24484949 ATTGAGAGGCTAAGGTGGGAGGG + Intergenic
988628747 5:32906323-32906345 ATTTTGAAGATAAAGATGGAAGG + Intergenic
989221024 5:38964224-38964246 ATATAAAAGGTAATGATGGAAGG - Intronic
989631625 5:43489222-43489244 ATTAATAAGCTAATAATGGAGGG + Intronic
990223361 5:53621108-53621130 ATTTTGAAACTACTGTTGGTTGG + Intronic
990720062 5:58684641-58684663 ATTTAGCAGCTCATATAGGAGGG + Intronic
991347102 5:65680948-65680970 ATATAGAATCTTAAGTTGGAGGG - Intronic
992040400 5:72825202-72825224 ATTGAGAAAATACTGTTGGAAGG - Intronic
992589245 5:78276433-78276455 ATTTAGAAGCAAATTTAGGCTGG + Intronic
993361850 5:86987388-86987410 ATTTAGAATCTACTTTTGTAAGG - Intergenic
994761581 5:103861234-103861256 ATTTGGAGTCTGATGTTGGAGGG - Intergenic
995123103 5:108556067-108556089 ATTTAGAAGGTAATATTGTTAGG + Intergenic
997068949 5:130596165-130596187 ATTTAGAGTCAAATGTTTGAGGG - Intergenic
997546273 5:134710837-134710859 ATTTAAAAGCTCGTGTTGGCCGG + Intronic
999576835 5:152988244-152988266 ATTTAGAAGATAATGTCTGATGG + Intergenic
999817887 5:155196046-155196068 CTCTAGAAGCTTAAGTTGGAAGG - Intergenic
1000071153 5:157742359-157742381 AATTAGAAGCCACTGTTTGATGG + Intergenic
1003677956 6:8224310-8224332 ATTTGGAATCCAATGTTTGAAGG - Intergenic
1003677967 6:8224383-8224405 ATTTGGAATCCAATGTTTGAGGG - Intergenic
1004276410 6:14240175-14240197 ACTTAAAAGCTAGTGTCGGATGG + Intergenic
1005253450 6:23973171-23973193 ATTTAGAAGTAAATGGTGTAGGG - Intergenic
1007131130 6:39475056-39475078 GTTAAGAAACAAATGTTGGAAGG + Intronic
1008452173 6:51665771-51665793 AGTGAGAGGCTAATGTTGGAGGG + Intronic
1009639461 6:66314252-66314274 ATTTAGAAGCTAACCTTGTTGGG - Intergenic
1012597861 6:101061173-101061195 ATTTTGAAGCTAATTTTAGTAGG + Intergenic
1013629918 6:111976390-111976412 ATATAGAAGCCAGTGTAGGAGGG - Intergenic
1013768896 6:113605098-113605120 ATTAAGAAAATAAAGTTGGAGGG - Intergenic
1014046467 6:116893709-116893731 ATTTGGAACCTAATGTTTTAGGG + Intronic
1016178245 6:141107769-141107791 ATTTAGAATCTCATGTGGTAAGG - Intergenic
1017480533 6:154849910-154849932 ATTTAGAAGATAAAGTTGAAGGG + Intronic
1017984404 6:159430684-159430706 ACTTAGAAGCAACTGGTGGAGGG - Intergenic
1018716939 6:166540629-166540651 ATTTAGATGCTAATTTGTGAGGG + Intronic
1020998810 7:15301140-15301162 ATTTAAAAGCAAATGCTGGCCGG + Intronic
1021942436 7:25691093-25691115 ACTTAGAGTCTAATGTTCGAAGG + Intergenic
1022199247 7:28100063-28100085 GTCTAAAATCTAATGTTGGAAGG + Intronic
1022344648 7:29502595-29502617 TTTAAGAAGCTAATCTTTGAAGG - Intronic
1022823725 7:33987417-33987439 CTTGAGAAGGGAATGTTGGATGG - Intronic
1022998084 7:35779088-35779110 ATTTGAAAGATAATGGTGGAAGG + Intergenic
1023268790 7:38437015-38437037 ATTTTGCAGCAAATGTTGGGAGG - Intronic
1023762333 7:43477825-43477847 ATTTAGAAATTATTCTTGGAAGG - Intronic
1024773951 7:52760058-52760080 ATTTAGAAGAGCATGTTGGGAGG + Intergenic
1027942313 7:84698903-84698925 ATTTAGGATCCAATTTTGGAAGG + Intergenic
1028281975 7:88941759-88941781 CTTTAGAAGATAATGTTGTGTGG + Intronic
1030478887 7:110076744-110076766 ATTTAGAAAAGAATGTTGGTTGG + Intergenic
1031402818 7:121345760-121345782 ATTTAAAAGCAAATGATGGTTGG - Intergenic
1031428365 7:121635555-121635577 ATTTAGAAGATAAGCTTAGATGG - Intergenic
1032052883 7:128659998-128660020 TTTTATAACCTAATCTTGGAAGG + Intergenic
1033826852 7:145201461-145201483 ATTTAGAAGAAAATCTAGGACGG - Intergenic
1038104049 8:24413609-24413631 GTTTAGAAGATAATTTTGCAGGG + Intergenic
1038787617 8:30634535-30634557 AATTAGAATTTAATGTTTGATGG - Intronic
1040100362 8:43495572-43495594 ATTTTAAAGCTAATGAGGGATGG + Intergenic
1041280662 8:56209244-56209266 CTTTGGAAGCTGATTTTGGAAGG - Intronic
1042311621 8:67384575-67384597 ATTGAAAAGCTAATATTTGAGGG - Intergenic
1045580690 8:103476399-103476421 ATTTTAAAGGTAATGTTGGCAGG + Intergenic
1046607249 8:116385027-116385049 ATTTAGAAGCTCTGTTTGGATGG - Intergenic
1046671889 8:117065353-117065375 ATTTAGAACCTAAAGAAGGAAGG + Intronic
1046836198 8:118804459-118804481 ATTTTAAAGATAAAGTTGGATGG + Intergenic
1052196735 9:25726090-25726112 AATTGGAAGGTAATGTTGTATGG - Intergenic
1052725258 9:32221441-32221463 ATTTGGAATCTGATGTTTGAGGG + Intergenic
1055361261 9:75493019-75493041 ATTTTAAATCTAATGTTAGAAGG + Intergenic
1056374732 9:85996820-85996842 ATTAAGAAGCCGATGTTGAAGGG + Intronic
1056435431 9:86571189-86571211 ATTTGGAATCTGATGTTAGAAGG - Intergenic
1056672049 9:88638748-88638770 ATTTGGAAGCTGGTGTTGCATGG - Intergenic
1058515544 9:105769792-105769814 ATTTATAAGCTAATTTAGGGAGG + Intronic
1058846032 9:108960275-108960297 ATTTAAAAACTAATATTGGTAGG - Intronic
1061596458 9:131633163-131633185 ATTTAGAAGTTAATATTTAAGGG + Intronic
1185715933 X:2342107-2342129 ATTTAGAAGCTTTTGTTTGTGGG + Intronic
1186037129 X:5436370-5436392 ATTTAGATGGTAATATTGGATGG + Intergenic
1186706203 X:12141326-12141348 ATTTAGAAGCTCAAGTTTGTAGG - Intronic
1188909443 X:35827868-35827890 ATTTAGTAGCTAATTATGTAAGG - Intergenic
1190904641 X:54714394-54714416 GTTTAGAAGCTATTCTTGAAAGG + Intergenic
1191889562 X:65926325-65926347 ATTTAAAAGCTAGGGTGGGAGGG - Intergenic
1193829710 X:86274792-86274814 CTTTAGAATTTAATGTTGGCAGG - Intronic
1194040811 X:88940079-88940101 ATCTAGAATCTAATGTTTCAAGG + Intergenic
1194410345 X:93550076-93550098 ATTTAAAAGATAATGTTAGTTGG - Intergenic
1194728861 X:97431071-97431093 ATTTTGAAGGTAATGCTGCATGG + Intronic
1194835674 X:98679532-98679554 ATTTATAATATAATGTTGGGGGG + Intergenic
1194865520 X:99061107-99061129 ATTTAGATTGTAATGTTGAAGGG + Intergenic
1196084362 X:111668375-111668397 ATTTAGAAACTGATTTTGGGAGG + Intronic
1196267575 X:113669191-113669213 ATTTAGAAGCTGATGTGGTTTGG + Intergenic
1196396154 X:115263507-115263529 ATTTAGAAGCTATTATTGATGGG + Intergenic
1196430737 X:115622341-115622363 ATTCAGAAACTCATGCTGGATGG + Exonic
1196486313 X:116213514-116213536 TTTTATAAGCTAATATGGGAAGG + Intergenic
1197003307 X:121465907-121465929 ATTTAGAGTCCAATGTTTGATGG - Intergenic
1197013746 X:121598849-121598871 AGTTAGAGTCCAATGTTGGAGGG + Intergenic
1197084652 X:122457071-122457093 ACTTAGAGTTTAATGTTGGAGGG + Intergenic
1197162929 X:123344419-123344441 AGTTATAAGCTAATGGTGAATGG + Intronic
1197203320 X:123768049-123768071 CTTTAGAGGCTGATGTGGGAGGG - Intergenic
1197300377 X:124772713-124772735 ATTAAAAAGCTGATGTTGAAAGG + Intronic
1198147773 X:133874890-133874912 ATTTAGAAGGTAAAGTTTTAGGG + Intronic
1199680027 X:150217863-150217885 ATGTAGAAGATAAAGTTGAAGGG + Intergenic
1202092307 Y:21206489-21206511 ATTTATAAGTTAATCTTGGTAGG - Intergenic