ID: 1128829022

View in Genome Browser
Species Human (GRCh38)
Location 15:70749487-70749509
Sequence TTATCGCCCAGGCCAGAGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5996
Summary {0: 1, 1: 3, 2: 50, 3: 594, 4: 5348}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128829022_1128829025 26 Left 1128829022 15:70749487-70749509 CCGCACTCTGGCCTGGGCGATAA 0: 1
1: 3
2: 50
3: 594
4: 5348
Right 1128829025 15:70749536-70749558 ACAAAAACAAAAAATTAGCCAGG 0: 71
1: 1209
2: 66004
3: 77947
4: 125653

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128829022 Original CRISPR TTATCGCCCAGGCCAGAGTG CGG (reversed) Intronic
Too many off-targets to display for this crispr