ID: 1128831304

View in Genome Browser
Species Human (GRCh38)
Location 15:70771881-70771903
Sequence CAGTGTGGCTGGAGCATAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128831296_1128831304 26 Left 1128831296 15:70771832-70771854 CCTAAGCAGTGTGGTATGGCTTG No data
Right 1128831304 15:70771881-70771903 CAGTGTGGCTGGAGCATAGTGGG No data
1128831295_1128831304 27 Left 1128831295 15:70771831-70771853 CCCTAAGCAGTGTGGTATGGCTT No data
Right 1128831304 15:70771881-70771903 CAGTGTGGCTGGAGCATAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128831304 Original CRISPR CAGTGTGGCTGGAGCATAGT GGG Intergenic
No off target data available for this crispr