ID: 1128831855

View in Genome Browser
Species Human (GRCh38)
Location 15:70776777-70776799
Sequence TAGGGGACTCAGAAGCGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128831855_1128831861 -2 Left 1128831855 15:70776777-70776799 CCCTGCCGCTTCTGAGTCCCCTA No data
Right 1128831861 15:70776798-70776820 TAATTTTTTTTCCATAGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128831855 Original CRISPR TAGGGGACTCAGAAGCGGCA GGG (reversed) Intergenic
No off target data available for this crispr