ID: 1128836151

View in Genome Browser
Species Human (GRCh38)
Location 15:70810660-70810682
Sequence GGATGGTCTCAATTTTTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128836145_1128836151 -6 Left 1128836145 15:70810643-70810665 CCGCGCCCAGCCAGGCAGGATGG No data
Right 1128836151 15:70810660-70810682 GGATGGTCTCAATTTTTGCTGGG No data
1128836141_1128836151 25 Left 1128836141 15:70810612-70810634 CCTAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1128836151 15:70810660-70810682 GGATGGTCTCAATTTTTGCTGGG No data
1128836139_1128836151 28 Left 1128836139 15:70810609-70810631 CCTCCTAAAGTGCTGGGATTACA 0: 7478
1: 303200
2: 267528
3: 154064
4: 197026
Right 1128836151 15:70810660-70810682 GGATGGTCTCAATTTTTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128836151 Original CRISPR GGATGGTCTCAATTTTTGCT GGG Intergenic
No off target data available for this crispr