ID: 1128840500

View in Genome Browser
Species Human (GRCh38)
Location 15:70847014-70847036
Sequence GTTGAGAGTAGAACTCAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 119}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128840500 Original CRISPR GTTGAGAGTAGAACTCAAGC TGG Intronic
901289584 1:8113544-8113566 CTTGAGACAAGAACTCAACCTGG - Intergenic
905555032 1:38875738-38875760 GTTAAGAGTAGAACTGGAGGAGG - Exonic
915988869 1:160492985-160493007 GTTGAGAGTAGAGTTCAAGGGGG - Intronic
917199487 1:172499937-172499959 ACTGAGACTAGAGCTCAAGCAGG + Intergenic
919069777 1:192739412-192739434 GTAGAGAGTAGAATTGAGGCAGG + Intergenic
1063645785 10:7881762-7881784 GTTGGAAGGAGAACTCAAGCTGG - Intronic
1065811237 10:29445687-29445709 GTTGAGGGCAGAGCTCAACCTGG + Intergenic
1068207662 10:53877095-53877117 CTTGAGAGTACAAAACAAGCAGG + Intronic
1069526572 10:69177315-69177337 GTGGGGAGTAGAAATAAAGCTGG + Intergenic
1070053938 10:72916070-72916092 GATGAGAGTAGAACTCATTAGGG - Intronic
1071681352 10:87708672-87708694 TTTGAGAGTATAATTCAAACTGG - Intronic
1076305879 10:129465767-129465789 GTTCAGAGGAGAACTTCAGCAGG - Intergenic
1079723554 11:23849588-23849610 GTAGAGAGGACAAGTCAAGCTGG + Intergenic
1079903108 11:26212284-26212306 GATCAGAGTAGAACTGAAGGAGG + Intergenic
1081476928 11:43442607-43442629 GCTTAGAGGAGAACTCAAGAGGG + Intronic
1083057189 11:59833953-59833975 GTTGAGAGTGGAACCCAGGTTGG - Intronic
1084848402 11:71918918-71918940 ATTGAAAGTAGAACTACAGCTGG - Exonic
1085323328 11:75588210-75588232 TGTGAGAGTAGAGCTCAGGCAGG + Intronic
1085715123 11:78865658-78865680 GTTCAGACTAGAAGTCAAACGGG - Intronic
1091059552 11:132448743-132448765 GCTAACAGTAGAACTCAAGGAGG + Intronic
1093102738 12:15047583-15047605 GCTGAGAGTAGTTCTCTAGCTGG + Intergenic
1100609821 12:96182309-96182331 ATTGAAAGTAGAAGGCAAGCTGG - Intergenic
1103063978 12:117881808-117881830 GTTGAGAATTGAAGTCCAGCAGG + Intronic
1107659564 13:42625116-42625138 GTGGAGAGTAGAACTTAATTGGG + Intergenic
1109584974 13:64387921-64387943 GTTAATAGAAGAACTCAGGCTGG - Intergenic
1109878969 13:68446040-68446062 GTTAAGAGTAGAAGTCAGGTTGG + Intergenic
1112298775 13:98211696-98211718 GGTGAGAATTGAACTCAAGTTGG - Intronic
1114251484 14:20965536-20965558 GACAAGAGTTGAACTCAAGCAGG - Intergenic
1117437276 14:55728634-55728656 GTTGCCAGTAGAACTCAAGAAGG - Intergenic
1118418328 14:65570089-65570111 GTTTAAGGTAGACCTCAAGCAGG + Intronic
1120597242 14:86456144-86456166 GTTCAGAGTAGAATTCTAGTTGG + Intergenic
1120702843 14:87716758-87716780 GTGGAGGGTAGAAATCAAGAAGG - Intergenic
1121335558 14:93075776-93075798 GCAGAGAGGGGAACTCAAGCTGG - Intronic
1124184616 15:27513084-27513106 GATGAGAGGAGATATCAAGCAGG + Intronic
1128840500 15:70847014-70847036 GTTGAGAGTAGAACTCAAGCTGG + Intronic
1130297161 15:82655573-82655595 GTTGAGGGTGGAACTCAAAGTGG - Intergenic
1132238075 15:100236957-100236979 GATGAGAGGAGAATTGAAGCTGG - Intronic
1134426719 16:14155961-14155983 GATGAGAGGAGAGCTTAAGCAGG - Intronic
1137289256 16:47040692-47040714 GTGGAGAGTGGAACTGAAGTCGG + Intergenic
1137944413 16:52719992-52720014 GTTGGGAGTTGAACCCTAGCTGG - Intergenic
1138722966 16:59103474-59103496 GTAAAGAATATAACTCAAGCAGG + Intergenic
1138823247 16:60286977-60286999 GATGACAGTAGAACTGATGCTGG - Intergenic
1150890091 17:69138262-69138284 GTTGAGAGTGGAAGTAAAGTAGG - Intronic
1153823096 18:8849110-8849132 GTTAAGAGTACAGCTCATGCAGG + Intergenic
1155290415 18:24335386-24335408 GCTGGGATTTGAACTCAAGCAGG + Intronic
1157558823 18:48632077-48632099 GTTGAGAGCAGAATCCCAGCAGG + Intronic
1158086085 18:53653360-53653382 GTTGAGAGTCGAACCCACCCAGG - Intergenic
1158842050 18:61397698-61397720 GCTGAGATTAGAACCCAGGCAGG - Intronic
1159269055 18:66125234-66125256 TTTGATAGTACAACTCAAGCAGG + Intergenic
1162885452 19:13693689-13693711 GTAGAAAGTATAACTTAAGCCGG - Intergenic
1163653546 19:18532488-18532510 GTCGAAGGTGGAACTCAAGCTGG - Intronic
1167444837 19:49531472-49531494 ATTGAGAGTAGAACTGAGGGAGG + Intronic
928246858 2:29637925-29637947 GTTGCTATTAAAACTCAAGCTGG + Intronic
928936160 2:36680349-36680371 TTGGAGGATAGAACTCAAGCTGG - Intergenic
929726810 2:44438167-44438189 GCTGGGAGTTGAACTCAGGCAGG + Intronic
932493566 2:72135784-72135806 CCTGAGACTAGACCTCAAGCAGG + Intronic
933916155 2:86995886-86995908 GTTGAGAGAAAAATTGAAGCTGG + Intronic
934006838 2:87774016-87774038 GTTGAGAGAAAAATTGAAGCTGG - Intronic
935967720 2:108497855-108497877 GTTGAGAGAAAAATTGAAGCTGG + Intronic
936131383 2:109846125-109846147 GTTGAGAGAAAAATTGAAGCTGG + Intronic
936213314 2:110525360-110525382 GTTGAGAGAAAAATTGAAGCTGG - Intronic
936422453 2:112379914-112379936 GTTGAGAGAAAAATTGAAGCTGG - Intronic
940040015 2:149350441-149350463 GTTCAGAGTACAACTCCTGCAGG + Intronic
942217262 2:173733502-173733524 GCTGAGATCAAAACTCAAGCAGG + Intergenic
943463520 2:188199355-188199377 GTTGAGCTCAGAAGTCAAGCTGG + Intergenic
944220231 2:197296108-197296130 CTGGTGAGTTGAACTCAAGCAGG - Intronic
945410305 2:209498988-209499010 TTTGAGAGAGGAATTCAAGCAGG - Intronic
946462304 2:219879528-219879550 GAAGGAAGTAGAACTCAAGCTGG - Intergenic
947080655 2:226392200-226392222 GTGGAGAGTAGAAAACAAGCTGG + Intergenic
1169414425 20:5403674-5403696 TTTGAGAGAGGAATTCAAGCTGG - Intergenic
1169739795 20:8879924-8879946 GCTGAGAGTAGAACCCAGACAGG + Intronic
1170114913 20:12847000-12847022 AGTGAGATTGGAACTCAAGCTGG - Intergenic
1170385883 20:15816388-15816410 GTTGCCAGTAGAATTCAGGCTGG - Intronic
1170420340 20:16186319-16186341 GTTGAGGGTAAAAATGAAGCTGG + Intergenic
1170908384 20:20538327-20538349 GAGGAGAGTAGAAATCAGGCAGG + Intronic
1171777357 20:29381402-29381424 TATAAGAGAAGAACTCAAGCAGG - Intergenic
1172632027 20:36385079-36385101 GTTGGCAGTAGGACTCAGGCTGG + Intronic
949931772 3:9084160-9084182 GTTGTGAGTAGCAGGCAAGCTGG + Intronic
957916747 3:86695856-86695878 GATGAGAAAAGAACTCTAGCTGG + Intergenic
960668339 3:120132513-120132535 GTTAAGAGTGGAACTAAAGGTGG + Intergenic
962653438 3:137518657-137518679 GTTGAGAGGACAACTGAATCAGG - Intergenic
963389746 3:144645540-144645562 TATGACTGTAGAACTCAAGCTGG + Intergenic
974938116 4:68431856-68431878 GTAGAGAGTAGATTTCAAGAAGG - Intergenic
975077295 4:70226953-70226975 GGAGAGAATAGAATTCAAGCAGG - Intronic
977158597 4:93605968-93605990 GTAGAAAGTAGAACTGAGGCTGG + Intronic
982990727 4:162270423-162270445 ATTCAGAATAGAAATCAAGCAGG - Intergenic
989139404 5:38188527-38188549 GGTCAGAGTAGAACACAGGCTGG - Intergenic
990623411 5:57584773-57584795 GTTGAAGGTAGAGCACAAGCAGG - Intergenic
990644724 5:57831357-57831379 GTTGAGATTAAAACTCAAGTGGG - Intergenic
993267153 5:85740520-85740542 TTTGAGGGAAGAATTCAAGCTGG - Intergenic
993681768 5:90886983-90887005 GTTGAGAGAAGAGGTGAAGCAGG - Intronic
1001337833 5:170815160-170815182 GATTACAGTAGACCTCAAGCTGG + Intergenic
1003032288 6:2612327-2612349 GTCGAGATTTGAACCCAAGCAGG - Intergenic
1008647452 6:53529702-53529724 GTGGTGACTAGAACTCTAGCAGG - Intronic
1009645504 6:66395956-66395978 GTAGAGAGTAGACCCAAAGCGGG - Intergenic
1009857777 6:69286381-69286403 GTTGAAAGTAGAAAGCAAGAGGG - Intronic
1014184939 6:118424182-118424204 GATCAGAGCAGAACTGAAGCAGG + Intergenic
1014613170 6:123568921-123568943 TTTGAGAGAGGAATTCAAGCAGG - Intronic
1016727503 6:147392096-147392118 GTTCAGAGTCGAACTCAGCCCGG - Intergenic
1017427866 6:154341218-154341240 GCTAAGAGGAAAACTCAAGCTGG - Intronic
1018786082 6:167108989-167109011 GTTGAGGGTGGAGCTCAGGCAGG - Intergenic
1022260587 7:28700694-28700716 GGAGAGAGTTGAAATCAAGCAGG - Intronic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1025034795 7:55587426-55587448 GTTGAGTGAAGACCTCACGCTGG + Intergenic
1025301927 7:57825032-57825054 GTTCAGAGCAGAGCTCAGGCAGG - Intergenic
1032883168 7:136111848-136111870 GATGAGAGCAGAACTGAAGGAGG - Intergenic
1033682919 7:143613653-143613675 TTTAAGAGTAGAAGCCAAGCAGG - Intergenic
1033701692 7:143843989-143844011 TTTAAGAGTAGAAGCCAAGCAGG + Intergenic
1033741764 7:144281763-144281785 GTTGGGAGTAACAATCAAGCAGG + Intergenic
1033752137 7:144367851-144367873 GTTGGGAGTAACAATCAAGCAGG - Intronic
1034746239 7:153526417-153526439 GTTGGGATCTGAACTCAAGCAGG - Intergenic
1044046272 8:87437941-87437963 ATTGGGAGTAGAACTGAAGGAGG - Intronic
1044723977 8:95177315-95177337 GTTGAGATTACAACACAGGCTGG - Intergenic
1048205010 8:132408409-132408431 GTAGAGAGTCGAACACCAGCTGG - Intronic
1048552634 8:135448088-135448110 GTTGAGAGTAGATCTAGAGGAGG - Intergenic
1048676647 8:136791413-136791435 GTTGACAGTAGACCTCATGAGGG - Intergenic
1050479727 9:6077182-6077204 GTTGAGAGAAGAAGTGAAGCTGG - Intergenic
1058626602 9:106939831-106939853 GGTGAGATGAGAAATCAAGCAGG - Intronic
1059156438 9:111992968-111992990 GTTGATATTAGAAATCAAGATGG - Intergenic
1061528326 9:131187681-131187703 GTTAAAAGTAAAACTCAGGCCGG - Intronic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1188974859 X:36661005-36661027 GTTGACAGCAGAGCTCAAGTTGG + Intergenic
1189017908 X:37303329-37303351 GTTGAGAGAAGACCTTAAACAGG + Intergenic
1190927860 X:54924753-54924775 GTGGAGAGGAGAGCTCAAGGAGG - Intronic
1191715012 X:64188183-64188205 GTTGAGAGAAGAAGTCAACAGGG - Exonic
1199537542 X:148920180-148920202 ATTGAGAGTAGAACTCCCCCAGG + Intronic
1200855894 Y:7937824-7937846 GTTGTGAGCAGAACTTAGGCAGG + Intergenic