ID: 1128851566

View in Genome Browser
Species Human (GRCh38)
Location 15:70963007-70963029
Sequence TGTTAATTCCAGCACTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6135
Summary {0: 1, 1: 11, 2: 50, 3: 565, 4: 5508}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128851561_1128851566 -2 Left 1128851561 15:70962986-70963008 CCTGGGCATAGTGGTCATGCCTG 0: 1
1: 1
2: 3
3: 14
4: 162
Right 1128851566 15:70963007-70963029 TGTTAATTCCAGCACTTTGGGGG 0: 1
1: 11
2: 50
3: 565
4: 5508
1128851560_1128851566 1 Left 1128851560 15:70962983-70963005 CCACCTGGGCATAGTGGTCATGC 0: 1
1: 0
2: 0
3: 15
4: 119
Right 1128851566 15:70963007-70963029 TGTTAATTCCAGCACTTTGGGGG 0: 1
1: 11
2: 50
3: 565
4: 5508

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128851566 Original CRISPR TGTTAATTCCAGCACTTTGG GGG Intronic
Too many off-targets to display for this crispr