ID: 1128854958

View in Genome Browser
Species Human (GRCh38)
Location 15:71002407-71002429
Sequence GTGAATAGTGAAATCATTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128854958_1128854961 18 Left 1128854958 15:71002407-71002429 CCACTAATGATTTCACTATTCAC 0: 1
1: 0
2: 0
3: 21
4: 183
Right 1128854961 15:71002448-71002470 ACAGTAAAATGACATATTGCAGG 0: 1
1: 1
2: 1
3: 17
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128854958 Original CRISPR GTGAATAGTGAAATCATTAG TGG (reversed) Intronic
902763298 1:18598441-18598463 ATGAATAATGACACCATTAGTGG - Intergenic
907157677 1:52349389-52349411 GTGTTTAGTAAAATCATTTGTGG + Intronic
907266484 1:53264654-53264676 GTGATTATGGAAAGCATTAGAGG + Intronic
908811080 1:67982912-67982934 GGGAATAGAGATAACATTAGGGG - Intergenic
908917216 1:69142735-69142757 GTGAATAGAGAAATAAATTGTGG + Intergenic
909824190 1:80105668-80105690 GTGATTAGTGATATAATTACTGG + Intergenic
910835542 1:91505318-91505340 GTGAGATGTGAAACCATTAGAGG + Intronic
912739467 1:112180439-112180461 GAGAATAGTGAAAGCCTTAATGG + Intergenic
912930463 1:113954594-113954616 GTGAAAAGGGAAATTATTAAAGG - Intronic
919266770 1:195278232-195278254 ATGAAGAGTGTAATTATTAGGGG + Intergenic
919281720 1:195498026-195498048 GTGAAAAGTGAAAACAGTAAAGG - Intergenic
919566159 1:199191493-199191515 ATGGATCGTGAAATAATTAGTGG + Intergenic
921670506 1:217919098-217919120 GTAAGTAGTGAAGTCCTTAGGGG + Intergenic
922056267 1:222045306-222045328 ATGAAATGTGAAATCATTATTGG - Intergenic
924237091 1:242008154-242008176 CTGACTCGTGAAGTCATTAGAGG - Intergenic
1062906406 10:1182682-1182704 ATGAATAGTGAAAATAATAGAGG + Exonic
1062991180 10:1820689-1820711 GTGAATTTTGATATCAATAGGGG + Intergenic
1065869408 10:29943582-29943604 GTTAATAATAAAATCATTACTGG + Intergenic
1067109543 10:43390460-43390482 GGGAATGGTGAAATCATTGGAGG - Intronic
1070963818 10:80517403-80517425 GTGAGCAGGGAAATCATGAGAGG - Intronic
1073128812 10:101171644-101171666 GTGCATAGTGACATATTTAGGGG - Intergenic
1073157471 10:101359094-101359116 GTCAACAGTGACATCATTAAGGG - Intronic
1074686859 10:115969843-115969865 GTGTACTGTGAACTCATTAGTGG - Intergenic
1075640050 10:124057974-124057996 GTGCACATTGAAATCATTGGGGG - Intronic
1075960722 10:126565946-126565968 GTGAATATGGAAATGATAAGGGG - Intronic
1076373713 10:129970156-129970178 GTGAATATTGAAGTCTTGAGTGG - Intergenic
1078860165 11:15239461-15239483 GTGAATAATGAAGTCATGAATGG - Intronic
1082187719 11:49204817-49204839 GCGAATCCTGCAATCATTAGAGG + Intronic
1082726006 11:56737489-56737511 GGGTATAATGACATCATTAGAGG + Intergenic
1082740422 11:56904857-56904879 GTGCATTGTGAAATCATAAGTGG + Intergenic
1085551067 11:77372695-77372717 GTGAATAGTGAAGGAAGTAGAGG - Intronic
1086432070 11:86745557-86745579 GTGAATAGTAAAAGCCTTGGAGG + Intergenic
1086678593 11:89640580-89640602 GGGAATCCTGCAATCATTAGAGG - Intergenic
1089513040 11:119012707-119012729 GTGTAGAGTAAAATCATAAGTGG - Intronic
1093661986 12:21767667-21767689 GAGAATACTGAAATGATTAAAGG + Intronic
1094008177 12:25778298-25778320 ATGAATATTGAAATAATTATTGG + Intergenic
1099438542 12:82671599-82671621 GTGAATAGTGAAATATCTATAGG - Intergenic
1102790729 12:115643264-115643286 GAGAATAGAGAAATCACTAAAGG + Intergenic
1104588416 12:130065289-130065311 CTGAACAGTGAAAACATTAAAGG + Intergenic
1106765664 13:32911241-32911263 ATGAAAAGTGAAGTCATTATTGG + Intergenic
1107478038 13:40759512-40759534 GTGAAAAGTGAAATGATTTTTGG + Intronic
1108169418 13:47725733-47725755 TTGAATAGTGAGAACATTTGAGG - Intergenic
1109582493 13:64360806-64360828 GTGAGAAGTAAAATCATTTGAGG + Intergenic
1109970726 13:69764843-69764865 GTGCATAATGCAATCATTTGGGG + Intronic
1110006161 13:70272835-70272857 GAGAATAGAGAAATCACCAGTGG - Intergenic
1113570689 13:111354610-111354632 GCGAATAGTGAAATAATGTGTGG + Intergenic
1116050146 14:39792543-39792565 GTGAATACTGAAATATTTGGAGG - Intergenic
1116160439 14:41260869-41260891 GTGTAGAGTGAAATCAGGAGGGG + Intergenic
1117218700 14:53579375-53579397 GTGAAGGGTGAATCCATTAGAGG + Intergenic
1118134440 14:63006595-63006617 CAGAATAGTCAAATCATGAGAGG + Intronic
1118164083 14:63318714-63318736 GAGAATAATGAATTCAGTAGGGG - Intronic
1119151253 14:72361669-72361691 GTGAATATTGAAATCACTACTGG + Intronic
1119917690 14:78417461-78417483 GTGAGAAGTGAAATGATGAGGGG - Intronic
1123506888 15:20951132-20951154 GTGAATAAAAAAGTCATTAGAGG + Intergenic
1126336247 15:47589103-47589125 GTGAGTAGTTAAACCATGAGTGG + Intronic
1127361447 15:58248079-58248101 GTCTATGATGAAATCATTAGAGG + Intronic
1128402128 15:67294224-67294246 ATAAATAGTGAAATAATGAGAGG - Intronic
1128854958 15:71002407-71002429 GTGAATAGTGAAATCATTAGTGG - Intronic
1130024526 15:80260103-80260125 CTTAATTGTGGAATCATTAGTGG + Intergenic
1130241657 15:82198984-82199006 CTGAAAAGTGAAATCTTTATTGG - Intronic
1131765259 15:95668786-95668808 GTGAATATTGTTATTATTAGTGG + Intergenic
1132293160 15:100717208-100717230 GTGATTAGGCAAATCATTAGCGG + Intergenic
1202972476 15_KI270727v1_random:251980-252002 GTGAATAAAAAAGTCATTAGAGG + Intergenic
1133540299 16:6746029-6746051 TTGAACAGTGAAATACTTAGAGG + Intronic
1139223556 16:65211174-65211196 ATGAATAGTGAAATAATTCATGG - Intergenic
1139726039 16:68899338-68899360 GTGAATATAGAAATCAGTAAGGG - Intronic
1140860815 16:79016226-79016248 GAGTACAATGAAATCATTAGGGG + Intronic
1145054464 17:19691300-19691322 GTGAATAGTGCAATAAATATGGG - Intronic
1146172215 17:30642955-30642977 ATGGATAGTAAAATCATTAGGGG + Intergenic
1146293804 17:31632496-31632518 GTTAATAGTAAAATCATGTGAGG + Intergenic
1146345671 17:32058993-32059015 ATGGATAGTAAAATCATTAGGGG + Intergenic
1149146691 17:53502263-53502285 GTGAATAGAGAAATAATCTGTGG - Intergenic
1153056936 18:955119-955141 GTCTATAGTGACATCAATAGAGG - Intergenic
1153061620 18:1000989-1001011 GAGAATAGGAAAATCATTTGAGG + Intergenic
1155791641 18:29977921-29977943 GAAACTAGGGAAATCATTAGAGG - Intergenic
1156356107 18:36341656-36341678 TTCAATAGTGTAATCTTTAGGGG - Intronic
1157175337 18:45446752-45446774 GTGACTACTGAAATGAATAGGGG + Intronic
1157737325 18:50061667-50061689 TTGAATAGTTAAATCTTTGGGGG + Intronic
1157781289 18:50441565-50441587 GTGAATAGTAAAATAGTTAGGGG + Intergenic
1158895225 18:61906414-61906436 ATGAATCTTGAAAGCATTAGAGG - Intergenic
1159096522 18:63908330-63908352 GGGAATTGTGAAATCATCAGTGG + Intronic
1162590839 19:11590076-11590098 ATGAATACTGAAATAATTGGGGG - Intronic
1162990207 19:14297076-14297098 ATGGATAGTAAAATCATTAGGGG - Intergenic
1163179461 19:15588653-15588675 GTGAATAGGGAATTTATTACAGG + Intergenic
1164717084 19:30400102-30400124 GAGAATAGTGAAATGAATTGTGG - Intronic
1168537506 19:57183476-57183498 CTGAATACTGATATCATTTGTGG + Intergenic
927379315 2:22460072-22460094 ATGAATAGTCACATCATTAGTGG - Intergenic
928251004 2:29680053-29680075 GGGAATATTGAAATGATTAATGG - Intronic
930548005 2:52794528-52794550 GAGAACAGTGGAATCATTTGTGG - Intergenic
931354676 2:61525511-61525533 GTGAAAAATGAGATGATTAGAGG - Intronic
931599091 2:63984752-63984774 GTAAATACTGAAATAATTTGTGG + Intronic
932942968 2:76190889-76190911 GTGAATAGAAAAATAATTAGTGG + Intergenic
935250186 2:101253693-101253715 GTGTATAGAGAAATCATTTTCGG - Intronic
935598986 2:104902832-104902854 GTGAATAGTTATTTCTTTAGTGG - Intergenic
937292447 2:120789914-120789936 GTGAATGGTGAAATTACTTGAGG + Intronic
937550978 2:123091304-123091326 GTGAATAGTGACATAATTTGAGG + Intergenic
940526802 2:154825972-154825994 GTTAATAGTCAAAAGATTAGTGG + Intronic
941153472 2:161944233-161944255 ATGATTAATGAAATCATTAGTGG + Intronic
941450968 2:165659475-165659497 GTGGATAGTGAGATCATTTTTGG + Intronic
941962842 2:171270408-171270430 GTGCATTGGGAAATCATTAGTGG - Intergenic
943016805 2:182522225-182522247 GTTAATAGTCAAATCTTTTGGGG + Intronic
943326655 2:186507012-186507034 GTGTATATTAAAATCATTAATGG + Intronic
944356290 2:198792332-198792354 ATGAATAGGGAAATGTTTAGTGG + Intergenic
945884245 2:215358091-215358113 GTGAATAAAGAAATGATCAGGGG - Intergenic
946906233 2:224419169-224419191 GAGAATAGTGAAATAAATTGTGG + Intergenic
947344725 2:229179024-229179046 GTGAGTAGTGAAAGAGTTAGTGG - Intronic
1170064252 20:12293463-12293485 GTGCACAGTGAACTCATAAGGGG + Intergenic
1174863233 20:54112081-54112103 GTGATTAGTGGATTCATCAGTGG + Intergenic
1175283033 20:57817824-57817846 AAGAATAGTGAAATCATTGATGG - Intergenic
1175447082 20:59029868-59029890 GTGATTTGTGAGAACATTAGTGG + Intronic
1179109974 21:38437937-38437959 GTGAGTTCAGAAATCATTAGGGG - Intronic
1182919806 22:34068902-34068924 ATGAAAAGTGAAATCAGTAAAGG - Intergenic
1182949702 22:34362019-34362041 GAGAATAGTGAAATCACTTGAGG + Intergenic
1185209754 22:49564135-49564157 GTGACTAGTGAATAAATTAGTGG - Intronic
1185293248 22:50039262-50039284 TTAACTAGTGAAATCATTATGGG + Intronic
950821959 3:15769849-15769871 GTGAACAGTAAAAACCTTAGGGG + Intronic
952175918 3:30862718-30862740 GTGAATATTGAAATCTTCAAAGG + Intronic
953849339 3:46454363-46454385 GTGAAAAGAGAAACCATCAGGGG + Intronic
955129733 3:56153704-56153726 GTGAATACTGAAATGGTGAGTGG + Intronic
956236845 3:67081951-67081973 GTGAAAAGTGCAATCATCAAAGG + Intergenic
959404674 3:105946010-105946032 GGGAATATTGAAATTAATAGAGG - Intergenic
959988685 3:112606237-112606259 GTGAATAGTGAAAAGAATAGAGG + Intronic
962715822 3:138125175-138125197 GTGCATAGTGAAATCTTTTCTGG - Intronic
963390221 3:144652757-144652779 TTGAATTGTGAAATCATTTCAGG - Intergenic
965152320 3:164993903-164993925 GTGATTAATTAAATCATGAGGGG + Intronic
967709812 3:192693375-192693397 ATGAAAAGTGAAATTATAAGAGG - Intronic
969126026 4:4948750-4948772 GTGAATAGTTAAATAAATACTGG + Intergenic
969964882 4:10983915-10983937 GTGTATAATGAGATCATCAGGGG + Intergenic
972024142 4:34355838-34355860 GTGATTTGAGAAATCATTAGTGG + Intergenic
974207355 4:58723480-58723502 GTGAATACTGAAGTCAATTGAGG - Intergenic
975207774 4:71664118-71664140 CTTAATAGTGAACACATTAGAGG - Intergenic
979144869 4:117233295-117233317 GTGAATTGTTAAGTCACTAGTGG - Intergenic
979348697 4:119620910-119620932 GGGAGAAGTGAAATCATTATAGG + Intronic
981728695 4:147874743-147874765 TTGAATAGTAAAATTATTAATGG + Intronic
983767858 4:171508523-171508545 GTAAAAAGTGAAAAAATTAGAGG - Intergenic
983976277 4:173938112-173938134 CTGCATAGTGCTATCATTAGAGG + Intergenic
984619598 4:181937317-181937339 GTGCATTGAGAAACCATTAGTGG + Intergenic
985364571 4:189214299-189214321 GTGAAAAATGAAGTCATCAGTGG - Intergenic
986984597 5:13485909-13485931 GTGCTTAGTGAAATCTCTAGGGG - Intergenic
987353092 5:17038548-17038570 CAGAACTGTGAAATCATTAGAGG - Intergenic
987452817 5:18107277-18107299 GTGAATAGTAACATCATATGAGG - Intergenic
988409126 5:30863975-30863997 GTGCATTGCGAAATCATTAAAGG + Intergenic
990092895 5:52077027-52077049 CTGAATAGAGATAGCATTAGGGG + Intronic
991146648 5:63314150-63314172 GGGAATAATGAAAACATAAGAGG + Intergenic
994070670 5:95598651-95598673 GTGAAATGGGAAATCAGTAGAGG - Intronic
995051380 5:107709244-107709266 TAGAAGAGTGAAATCATCAGTGG - Intergenic
995937500 5:117533679-117533701 GTGCATACTGAAATATTTAGGGG + Intergenic
996572510 5:124946997-124947019 GTGAAAAATGAAATCAAAAGAGG + Intergenic
996952403 5:129143184-129143206 GTGCATAGTAATATAATTAGTGG - Intergenic
997557996 5:134818392-134818414 GTCAATATTGAGATCATTATTGG - Intronic
999517478 5:152315514-152315536 TGGAACAGTGAAATCAATAGTGG + Intergenic
999616831 5:153433673-153433695 GTGAGTTGGGAAACCATTAGAGG - Intergenic
1001735515 5:173995401-173995423 ATGAATAGAGAAGTCACTAGTGG + Intronic
1002436049 5:179231754-179231776 GTGAATAGTGAAGTCAGCAGAGG + Intronic
1006270797 6:32965832-32965854 GTGGAAAGTAAAATCATAAGGGG + Intronic
1008251815 6:49249307-49249329 GTGAATAGTAAAACAAATAGTGG + Intergenic
1008513811 6:52300849-52300871 GTGATTAGTGACCTTATTAGTGG - Intergenic
1009672200 6:66770498-66770520 GAGAAGACTGAAATCAATAGAGG - Intergenic
1012720917 6:102743328-102743350 GTGAAAAGTGATTGCATTAGCGG + Intergenic
1013917773 6:115362993-115363015 GTAATTAGTGAAACCATTAGGGG + Intergenic
1015274740 6:131372629-131372651 ATGACTGGTGGAATCATTAGTGG - Intergenic
1015419824 6:132994255-132994277 GTGAACAGAGAAATCATGATAGG - Intergenic
1016747781 6:147599545-147599567 TTGACTAGTGAAATCCTTTGGGG + Intronic
1016917173 6:149254709-149254731 GAGAATAATGAAATCAGTTGAGG + Intronic
1017185909 6:151600268-151600290 ATGAATAGTGAAATTAATACAGG - Intronic
1018569347 6:165192131-165192153 GTGAAGAGAAAAATTATTAGGGG - Intergenic
1019141610 6:169950276-169950298 GTGAATGGTGAAATAGTTAATGG - Intergenic
1020826733 7:13037941-13037963 GTGAATAGTGAAACCATGTGGGG + Intergenic
1022946697 7:35292484-35292506 GCAAATAGTGGAATCATTTGTGG - Intergenic
1023476061 7:40579177-40579199 GTAAATGGTGAAATCAATCGAGG + Intronic
1025119995 7:56293681-56293703 GTGAATTGCAAAATCATTAGAGG + Intergenic
1026325549 7:69306258-69306280 GTGAAGAGTGAAAGCACTAAGGG + Intergenic
1027983800 7:85259318-85259340 GTGAATAAGGACATCATCAGAGG + Intergenic
1028767853 7:94580712-94580734 GTGCATTGTGAAATAATTGGTGG - Intergenic
1030528977 7:110688771-110688793 GTGAATAGTGAAATCTTATTTGG + Intronic
1031828480 7:126596534-126596556 GTAAATAGAGAACACATTAGTGG + Intronic
1033819191 7:145112990-145113012 GAAAATTGTGAAATGATTAGAGG + Intergenic
1035651826 8:1272114-1272136 GAGAATAATGAAATCATTCTAGG - Intergenic
1036052448 8:5215828-5215850 GTGAATAGTGAAAACAGATGTGG + Intergenic
1040692037 8:49950646-49950668 GTGAAAAGGGAAATAATCAGTGG + Intronic
1040692074 8:49951250-49951272 GTGAAAAGGGAAATAATCAGTGG + Intronic
1044064236 8:87680290-87680312 GTGTATAGTGAAGTTTTTAGAGG - Intergenic
1045476926 8:102561074-102561096 GTGAACATTGGAATAATTAGTGG + Intergenic
1046126900 8:109921117-109921139 GTGACGGGAGAAATCATTAGGGG + Intergenic
1046365432 8:113224570-113224592 GTGAACAGTAAATACATTAGAGG + Intronic
1047391327 8:124454085-124454107 CTGAATAGTGAAGTCTTCAGAGG + Intronic
1055074761 9:72202472-72202494 GTGAACAGTGAAATCATGCTTGG + Intronic
1056374662 9:85995783-85995805 GTGAAAAGTGAGATCACCAGTGG + Intronic
1056947071 9:91006748-91006770 TTGTATAGTGAAGTCCTTAGAGG - Intergenic
1187187609 X:17002127-17002149 GTGAATAGTAAAGTACTTAGGGG + Intronic
1187505010 X:19872338-19872360 GTGAAAGGTGAAATCCTTGGGGG - Intronic
1188000570 X:24976800-24976822 GTGAATACTGAAAACAGCAGTGG - Intronic
1188325830 X:28799785-28799807 ATGAATTGTGAAATAATTCGAGG + Intronic
1188788051 X:34373390-34373412 GTGGATAGTGAAATAATTTTAGG + Intergenic
1188899806 X:35716494-35716516 GTGTATATTAAAACCATTAGTGG + Intergenic
1189960652 X:46321967-46321989 GCAAAGAGAGAAATCATTAGAGG - Intergenic
1194856580 X:98936693-98936715 GTGAAGAGTGAAAAGATAAGGGG + Intergenic
1195418866 X:104651248-104651270 GTGAATAGGGAAATAATCATTGG - Intronic
1195881993 X:109602034-109602056 ATGAATAGTGAAACCATTTCTGG - Intergenic
1195913293 X:109911283-109911305 GGGAATACTCAAATCATTATGGG - Intergenic
1196417379 X:115486077-115486099 ATGAAGAGTTGAATCATTAGAGG + Intergenic
1196583839 X:117407008-117407030 GGGAATGGTGAAATAATTAATGG + Intergenic
1198091270 X:133332744-133332766 GAGAATAGTGTAATCATTGTGGG + Intronic
1198455399 X:136812678-136812700 ATGACTAGAGAAAACATTAGGGG + Intergenic
1199008809 X:142734113-142734135 GTGAATATTGAAAGCATGACAGG + Intergenic