ID: 1128856135

View in Genome Browser
Species Human (GRCh38)
Location 15:71018045-71018067
Sequence CTGTAAAAGGAGGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1305
Summary {0: 1, 1: 0, 2: 12, 3: 117, 4: 1175}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128856135 Original CRISPR CTGTAAAAGGAGGAGGAGGA GGG Intronic
900030102 1:365016-365038 TGGAAAGAGGAGGAGGAGGACGG - Intergenic
900050754 1:594080-594102 TGGAAAGAGGAGGAGGAGGACGG - Intergenic
900100512 1:960276-960298 CCGGAGGAGGAGGAGGAGGAGGG + Intergenic
900247132 1:1641760-1641782 GAGGAAGAGGAGGAGGAGGAAGG - Exonic
900258356 1:1708892-1708914 GAGGAAGAGGAGGAGGAGGAAGG - Exonic
900297873 1:1961179-1961201 TTTCAAAAGGAGGAGCAGGAGGG + Intronic
900816745 1:4853205-4853227 AGGATAAAGGAGGAGGAGGAAGG - Intergenic
900823542 1:4908616-4908638 CCGGAAAAGGAGGGGGAGCAGGG + Intergenic
900972429 1:5998949-5998971 CCGTGAAAGGAGGAAAAGGAAGG + Intronic
901105386 1:6751863-6751885 GAGTAGGAGGAGGAGGAGGAGGG - Intergenic
901232782 1:7650522-7650544 CTGGAAAAGGCGGGGGTGGAGGG - Intronic
901236446 1:7669964-7669986 CTGCAGAAAGTGGAGGAGGAGGG - Intronic
901420325 1:9146338-9146360 CAGGAAGAGGAGGAGGAGGAAGG - Intergenic
901484025 1:9545711-9545733 CTTTAAAAGGAGGCCGAGGCAGG + Intronic
901535628 1:9881279-9881301 CTGTAATAAGAGGCGGAGGTGGG - Intronic
901765250 1:11495863-11495885 CTGTAATAGGCAGGGGAGGAGGG - Intronic
903020992 1:20394179-20394201 CTACAAAAGGAGAAAGAGGATGG + Intergenic
903389922 1:22956389-22956411 GAGAAAGAGGAGGAGGAGGAAGG + Intronic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
903428603 1:23273864-23273886 CTGGAAGAGGAGGAGGAGATGGG + Intergenic
903491079 1:23729081-23729103 ATCTTGAAGGAGGAGGAGGAAGG - Intergenic
903548632 1:24142625-24142647 CTGACAGGGGAGGAGGAGGAAGG - Intronic
903549919 1:24150688-24150710 CAGCAGTAGGAGGAGGAGGAGGG + Intergenic
903549920 1:24150691-24150713 CAGTAGGAGGAGGAGGAGGGCGG + Intergenic
903687486 1:25142537-25142559 CTGGAAAGGCTGGAGGAGGAAGG + Intergenic
903947458 1:26972656-26972678 CAGAAATGGGAGGAGGAGGATGG + Intergenic
904021719 1:27471711-27471733 CTGACAAAGGAGGATCAGGAAGG + Intronic
904037482 1:27566679-27566701 GTGGAGGAGGAGGAGGAGGAGGG + Intronic
904428197 1:30445272-30445294 CTGTAAAATGGGGATGAGAATGG - Intergenic
904565804 1:31427685-31427707 CTGCAAAGTGAGGATGAGGATGG - Intronic
904607256 1:31704539-31704561 CTGTACTGGGAGGAGGAGGGTGG + Intergenic
904626089 1:31803816-31803838 GAGAAGAAGGAGGAGGAGGAGGG + Intronic
904920131 1:34000958-34000980 GAGTAGAAAGAGGAGGAGGAAGG + Intronic
905310180 1:37043574-37043596 CTGTCACAGGGGGAGTAGGAGGG + Intergenic
905371719 1:37486031-37486053 CTGTGAAAGGAGGAGAGGGAGGG + Intergenic
905791009 1:40789533-40789555 GAGTGCAAGGAGGAGGAGGAAGG - Intronic
906191973 1:43904758-43904780 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906191991 1:43904827-43904849 CAGGAATAGGAGCAGGAGGAGGG - Intronic
906192010 1:43904899-43904921 CGGGAAGAGGAGCAGGAGGAGGG - Intronic
906192249 1:43905754-43905776 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192337 1:43906081-43906103 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192381 1:43906225-43906247 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906273924 1:44501940-44501962 GAGAAAAAGAAGGAGGAGGAAGG + Intronic
906484254 1:46222123-46222145 CTGGAAAAGGAGAGGGAGCAAGG + Intergenic
906542922 1:46602034-46602056 TTGAAAGATGAGGAGGAGGAGGG + Intronic
906663286 1:47597803-47597825 CTCTAAAAGGGGGATCAGGATGG - Intergenic
906674730 1:47685092-47685114 TTGTAAAAGGAGTAGGTGGGAGG + Intergenic
907321691 1:53606640-53606662 CTGAAAGAGGAGCAGCAGGAAGG + Intronic
907330069 1:53664939-53664961 CTGTGGCAGGAGGAGGGGGAGGG + Intronic
907489138 1:54797928-54797950 CCAGGAAAGGAGGAGGAGGAGGG - Intronic
907680599 1:56559814-56559836 CTGGAAAATGGGGATGAGGAAGG + Intronic
907874965 1:58476870-58476892 CAGTACATGGAGGAAGAGGACGG + Intronic
907980985 1:59480598-59480620 ATTTAAAAAGAAGAGGAGGAGGG + Intronic
908512771 1:64862518-64862540 CTGTGGAGGGAGCAGGAGGAGGG - Intronic
909168893 1:72268196-72268218 ATATTAAAGGAAGAGGAGGAAGG + Intronic
909305504 1:74070749-74070771 CTGTTGAAGGGGCAGGAGGAAGG + Intronic
909392131 1:75130971-75130993 CTGTAGGAGGCGGTGGAGGATGG - Intronic
909659077 1:78062430-78062452 ATGTAAAAGTGGGTGGAGGAAGG + Intronic
909686550 1:78355217-78355239 CAAAAAAAGGAGGAGGAGAAAGG - Intronic
909975926 1:82046154-82046176 GTGAAAAAGGAAGAGGAGGCAGG - Intergenic
910094468 1:83505247-83505269 CTCTGGAAGGAGGAGGAGGCAGG - Intergenic
910250679 1:85195483-85195505 ATCTAAAAGGAGGAGAGGGATGG + Intronic
910549848 1:88463205-88463227 GGGAGAAAGGAGGAGGAGGAGGG - Intergenic
910581437 1:88829960-88829982 TTGGAAAAGGAGGAGAAGTATGG + Intronic
911584059 1:99669810-99669832 ATTAAAAAGGAGAAGGAGGAGGG + Intronic
911634772 1:100222744-100222766 CAGTGAAAGGAGGAGAAAGAGGG - Intronic
912314459 1:108654402-108654424 CTCTAAAGGGAGATGGAGGAGGG + Intronic
912708717 1:111934165-111934187 CTGTAAAAGTGGGAGGTGGGAGG + Intronic
912836219 1:112998696-112998718 CGGTACAAGGAAGAGGAAGAGGG - Intergenic
912993435 1:114510928-114510950 GTGGAGGAGGAGGAGGAGGAAGG - Exonic
913323714 1:117607781-117607803 GTGGAAAAGGGGGAGGGGGATGG + Intronic
913356892 1:117931671-117931693 CTGTAGAAGGAGGTGGTAGATGG + Intronic
914121092 1:144783186-144783208 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
914519645 1:148404094-148404116 AGAAAAAAGGAGGAGGAGGAAGG - Intergenic
914675512 1:149904724-149904746 CTCTAACAGGGGGAGAAGGATGG + Exonic
914923516 1:151863932-151863954 CTGGAGAAGGCAGAGGAGGAAGG - Intergenic
914988399 1:152478688-152478710 CTCTAACAGGAGGAGGGGGTGGG + Intergenic
915035307 1:152918726-152918748 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
915036872 1:152935186-152935208 ATGGAAAAGGAGGAGGAAAAAGG + Intergenic
915271374 1:154756065-154756087 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
915366784 1:155321288-155321310 CCCTGAAAGGAGGTGGAGGATGG - Intronic
916149335 1:161771206-161771228 AGGAGAAAGGAGGAGGAGGAGGG - Intronic
916407324 1:164510293-164510315 CAGGAAGAGGAGGAGGAGGTAGG - Intergenic
916508027 1:165445500-165445522 CTGTGAAAGGAGGAGGGGGTGGG + Intergenic
916818495 1:168375605-168375627 CTTTGAAAGGAGGTGGAGAAAGG + Intergenic
916881664 1:169024696-169024718 GAGGAAGAGGAGGAGGAGGAAGG + Intergenic
917000327 1:170350828-170350850 ATTAAAAAGGAGGAGGAGGAGGG + Intergenic
917526344 1:175791708-175791730 CTGTACAATGAGGAGGGCGATGG + Intergenic
918069512 1:181124595-181124617 AAGCAGAAGGAGGAGGAGGAGGG - Intergenic
918434666 1:184499148-184499170 GGGGAAGAGGAGGAGGAGGAAGG - Intronic
918440437 1:184561271-184561293 CCTTAAAATTAGGAGGAGGAGGG - Intronic
918758363 1:188367831-188367853 CAGCAAAAGGAGGGGCAGGAAGG - Intergenic
919010593 1:191956846-191956868 CTTTAAAAGGAGGAGGAAAGAGG + Intergenic
919420653 1:197365879-197365901 CTCTGAAAGGTGGAAGAGGAAGG - Intronic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919676880 1:200392796-200392818 CTGGTAAAGGCGGAGGAGGGAGG - Intergenic
920034663 1:203058195-203058217 CTGGCTGAGGAGGAGGAGGAGGG + Intronic
920210822 1:204327058-204327080 CTATCCCAGGAGGAGGAGGAGGG - Intronic
920217911 1:204374599-204374621 CTATAAAAGATGGAAGAGGAGGG - Intronic
920309697 1:205041860-205041882 CTGGAAAAGGAGAAGGAGTCGGG - Intergenic
920364507 1:205440960-205440982 CTGCAAAATGAAGAGGAAGAAGG - Intronic
920365098 1:205444125-205444147 ATGGAAAAGGAGGGGGAGGATGG - Intronic
920920365 1:210293018-210293040 CTGGAAAAGGAGGAGGCTGTGGG - Intergenic
921219879 1:212965886-212965908 CTGTAAGGGGTGGAGGCGGAGGG + Intronic
921334919 1:214076332-214076354 CTGGGAAAGGAAGAGGAAGAAGG + Intergenic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921818371 1:219589387-219589409 ATGAAAAAGGGAGAGGAGGAGGG + Intergenic
922338740 1:224638570-224638592 CTGTAAAAGGAGGGGTGGCAGGG + Intronic
922850234 1:228726858-228726880 CTGGAAGATGAGGGGGAGGAGGG + Intergenic
923051374 1:230393254-230393276 AGGGAAAAGGGGGAGGAGGAGGG + Intronic
923069020 1:230545880-230545902 CTAGAAAAGGTTGAGGAGGAGGG + Intergenic
923517732 1:234711607-234711629 GGGAAGAAGGAGGAGGAGGATGG - Intergenic
923570381 1:235108091-235108113 CTTTAAAAGGCCGAGGAGGGTGG + Intergenic
923713570 1:236406195-236406217 CTGTGATAGGAGGAGGGAGAAGG + Intronic
924467425 1:244311205-244311227 GTGGAAGAGGAGGAGGAAGAGGG - Intergenic
924608669 1:245556299-245556321 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
924853242 1:247852044-247852066 GTGTAAAATGAGGAGGAGAAAGG - Intergenic
924911997 1:248523048-248523070 CTGCACAAGGATGAGAAGGATGG - Intergenic
1062763404 10:44667-44689 AGGGAAGAGGAGGAGGAGGAGGG - Intergenic
1062833467 10:621566-621588 GAGGAAGAGGAGGAGGAGGAAGG + Intronic
1062953341 10:1522352-1522374 CTCTAAGAGGGGGAGGTGGAAGG + Intronic
1062964865 10:1599308-1599330 CTGCAAAATGAGGATGATGACGG + Intronic
1063133629 10:3198564-3198586 CTGTAAAAAGAAGAGGAAGGGGG - Intergenic
1063173371 10:3529760-3529782 CAGTCAGAGGAAGAGGAGGAGGG - Intergenic
1063438121 10:6050787-6050809 CAGGACGAGGAGGAGGAGGATGG + Intronic
1063572801 10:7231762-7231784 CCCGAAGAGGAGGAGGAGGAGGG - Intronic
1063621037 10:7649314-7649336 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1063929292 10:11013015-11013037 CAGGAAGAGGAGGGGGAGGATGG - Intronic
1064557660 10:16563530-16563552 CTGCAAAACTAGAAGGAGGAGGG + Intergenic
1064633967 10:17345088-17345110 CTGCAGCAGGGGGAGGAGGAGGG + Intronic
1064784639 10:18880532-18880554 GAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1065034612 10:21624977-21624999 CAGTAAGAGGAAGAGGAGGAAGG - Intronic
1065050376 10:21785806-21785828 ATGGAAAAGGAGGAGGGGAAGGG + Intronic
1065065437 10:21958940-21958962 TGGTAAAAGGAAGAGAAGGAAGG - Intronic
1065140390 10:22714132-22714154 GAGGAAGAGGAGGAGGAGGAAGG + Intronic
1065280743 10:24135182-24135204 CTCCAAGAGGAGAAGGAGGATGG + Intronic
1065328665 10:24571636-24571658 CTGCAGAAGGTGGAGGTGGAAGG - Intergenic
1065500860 10:26381097-26381119 GTGAAAGAGGAGGAGGAGGGAGG - Intergenic
1065790301 10:29254351-29254373 GAGGAAGAGGAGGAGGAGGATGG + Intergenic
1066262823 10:33745620-33745642 ATGGGAGAGGAGGAGGAGGAGGG + Intergenic
1066587538 10:36952905-36952927 CTGTATATGGAGAAGGAGGTGGG + Intergenic
1066660753 10:37736748-37736770 CTCTAAAAGGAAGAGGAAGGGGG - Intergenic
1067748243 10:48952664-48952686 CTGCATTAGGAGGAGGAGGGTGG - Intronic
1067770116 10:49116562-49116584 CTGTAGGAGGAGGAGGAGACAGG + Intergenic
1068022196 10:51598946-51598968 CTGAAACAGGAAGAGGAAGAGGG + Intronic
1068595103 10:58894802-58894824 GAGTAAAAGAGGGAGGAGGATGG + Intergenic
1069668738 10:70183598-70183620 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1069773513 10:70913875-70913897 AGGTGAATGGAGGAGGAGGAGGG + Intergenic
1070164385 10:73886942-73886964 CTGGAGAAGGAAGAGCAGGAAGG - Intergenic
1070326122 10:75390395-75390417 GAGAAAAAGGAAGAGGAGGAGGG - Intergenic
1070976409 10:80609304-80609326 AGGTAAAAGGAGGAGGAGGAAGG - Intronic
1071087447 10:81879054-81879076 CTTTAAAGGCAGGAGGAGAAAGG + Intronic
1071093286 10:81945270-81945292 AGGAAAAAGAAGGAGGAGGAAGG - Intronic
1071306573 10:84304321-84304343 CTGTACCAGGAAGAGAAGGATGG - Intergenic
1071388925 10:85150379-85150401 TAGGAAAAAGAGGAGGAGGAAGG - Intergenic
1071399658 10:85256891-85256913 CTGGCAAAGGAGGAGATGGAAGG - Intergenic
1071827790 10:89342429-89342451 TTGTTTAAGGAGCAGGAGGATGG - Intronic
1072251777 10:93587371-93587393 CTGGATCAGGATGAGGAGGATGG - Exonic
1072519521 10:96218775-96218797 CAGAAAGAGGAGGGGGAGGATGG - Intronic
1072563150 10:96595591-96595613 GTGGAACAGGTGGAGGAGGATGG + Exonic
1072785000 10:98273404-98273426 GAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1072946434 10:99813970-99813992 CTCTCAAAGGAGGAAGAGAAAGG - Intronic
1073045953 10:100638212-100638234 CTGGGAAAGGAGCAGAAGGAGGG + Intergenic
1073336514 10:102714289-102714311 CAGGAGGAGGAGGAGGAGGAGGG - Exonic
1073359659 10:102887849-102887871 CTGGAAAAAGAAGAGGAGGAAGG - Intronic
1073528055 10:104204656-104204678 GACTAAATGGAGGAGGAGGAGGG + Intronic
1073605819 10:104894770-104894792 ATGGAAAAGGAGAAGGAGGGAGG + Intronic
1074115119 10:110451172-110451194 CGGAAAAAGGTGGAAGAGGAAGG + Intergenic
1074202938 10:111256058-111256080 CTCTAGAAGGAGGAGGAAGAGGG + Intergenic
1074331230 10:112511706-112511728 TTGAATTAGGAGGAGGAGGAGGG - Intronic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1074691141 10:116005100-116005122 GAGAAAGAGGAGGAGGAGGAAGG - Intergenic
1074773772 10:116751071-116751093 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1075001991 10:118805434-118805456 CTGTCACAGGAGGACCAGGATGG - Intergenic
1075250112 10:120861247-120861269 GTGTTAAAGGAGGAAGAGAAAGG + Intronic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1075358073 10:121801821-121801843 CTCTAGCAGGAGTAGGAGGATGG - Intronic
1075614594 10:123882291-123882313 CTGTAAAGGCCAGAGGAGGAAGG + Intronic
1075759581 10:124845907-124845929 CTGGAGAATGAGGATGAGGATGG - Intergenic
1076318935 10:129564354-129564376 AAGGAAGAGGAGGAGGAGGAAGG - Intronic
1076323613 10:129602736-129602758 CTGGAAAGGAAGGAGGGGGAGGG - Intronic
1076369046 10:129940223-129940245 CTGCAAGGTGAGGAGGAGGAGGG - Intronic
1076762097 10:132611035-132611057 CTGTCAGAGGAGGATGAGGGAGG + Intronic
1076762148 10:132611219-132611241 CTGTCAGAGGAGGATGAGGGAGG + Intronic
1076762162 10:132611264-132611286 CTGTCAGAGGAGGATGAGGGAGG + Intronic
1077121435 11:910731-910753 CCGTGCAAGGAGGAGGAGCAGGG + Intronic
1077150767 11:1072172-1072194 GAGGGAAAGGAGGAGGAGGAAGG - Intergenic
1077245919 11:1538159-1538181 AAGTAAAAAGAGGAGAAGGAAGG - Intergenic
1077634373 11:3832032-3832054 CTGGAAAAGGATGATGAGTATGG + Intronic
1077924437 11:6666746-6666768 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1078303804 11:10161687-10161709 TTTTAAAAGGAGGAAGAGGGTGG + Intronic
1078558748 11:12352783-12352805 CTGTAAAAGGAGAGTGGGGAGGG + Intronic
1078795513 11:14588351-14588373 CTCTAACAGGAGTAGGTGGAGGG + Intronic
1079166084 11:18044727-18044749 CTGAAAGAGTAGGAGGAGGTGGG - Intergenic
1079296957 11:19242145-19242167 GTGTAGGAGGAAGAGGAGGAAGG + Intergenic
1079429358 11:20374119-20374141 ATGGGAAAGGAGGATGAGGAAGG + Intronic
1079445578 11:20553722-20553744 CTCAAGGAGGAGGAGGAGGAAGG - Intergenic
1079505055 11:21143955-21143977 CAGTAACAGGAGGTGAAGGAAGG + Intronic
1079703936 11:23589047-23589069 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1079944843 11:26729237-26729259 GTGGAAAAGAAGGATGAGGAAGG - Intergenic
1080404944 11:31970791-31970813 CTGTAAAATGAAGAGGCCGAAGG + Intronic
1080850825 11:36068409-36068431 CTGTAAAAGGAAGATAAAGATGG - Intronic
1081303044 11:41477024-41477046 CTGTTACAGAATGAGGAGGAGGG + Intergenic
1081644227 11:44778586-44778608 CTGTAAAATGGGGAGAGGGATGG + Intronic
1081864613 11:46352651-46352673 CTGTTCAAGGAGGAGGCAGAGGG - Intronic
1083776384 11:64896170-64896192 TTGTAAAGGGGGGTGGAGGACGG - Intronic
1083887741 11:65581081-65581103 CTTTGTGAGGAGGAGGAGGAAGG + Exonic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084603136 11:70158459-70158481 CTGTATCAGCAGGAGGGGGATGG - Intronic
1084746762 11:71175411-71175433 CTGTAAAGAGAGCAGGAGGAAGG + Intronic
1084785817 11:71441095-71441117 GTGGAAGAGGAGGAGGGGGATGG - Intronic
1084792598 11:71484059-71484081 CTGTCAGAGCTGGAGGAGGAGGG + Intronic
1085101077 11:73800591-73800613 CTGCAAGTGGAAGAGGAGGATGG - Intronic
1085324011 11:75592898-75592920 CTGTAAAATGGGAAGGAGCAGGG - Intronic
1085431543 11:76454918-76454940 CAGTATTAGGAGGGGGAGGAGGG - Intronic
1085522622 11:77147222-77147244 CTGTAAAAAGATTAGGGGGAGGG - Intronic
1085907670 11:80783784-80783806 CTGTAAATGGTACAGGAGGAAGG + Intergenic
1086427371 11:86699202-86699224 TTGTAAAATGAGTAGGAGGAGGG - Intergenic
1086598182 11:88600238-88600260 GAGGAAGAGGAGGAGGAGGAAGG - Intronic
1086651380 11:89295066-89295088 CTGTGAAAGGATGAAGATGATGG + Intronic
1086952596 11:92906235-92906257 GAGGAAAAGGAAGAGGAGGAGGG + Intergenic
1086990795 11:93302144-93302166 CAAAAAACGGAGGAGGAGGAGGG + Intergenic
1086998927 11:93393024-93393046 AAGTAGAAGGAGGAGGAGGAGGG - Intronic
1087213099 11:95463031-95463053 GTGTAGAAGGAAGAGGTGGAGGG + Intergenic
1087594757 11:100238529-100238551 GTAGAAGAGGAGGAGGAGGAGGG + Intronic
1087642579 11:100771365-100771387 CTTTAAAAGGTGGGGGTGGAGGG - Intronic
1087672848 11:101127893-101127915 AAGATAAAGGAGGAGGAGGAAGG - Exonic
1087904796 11:103683135-103683157 CTCTCAGAGGAGTAGGAGGAGGG - Intergenic
1088213060 11:107477393-107477415 CTGTAAAATGAGGATGATGATGG - Intergenic
1088229967 11:107663530-107663552 CTGTAAATATAGGAGAAGGAGGG - Intronic
1089096335 11:115922990-115923012 AGGTAAGAGGAGCAGGAGGAGGG - Intergenic
1089279958 11:117366996-117367018 CTGTGAAAGGAGGAGACAGAAGG + Intronic
1089299868 11:117492176-117492198 CTGTCATAGGAGGTAGAGGAGGG - Intronic
1089548660 11:119252190-119252212 ATGTAAATGGAGTAGGGGGAGGG - Intronic
1089749996 11:120644607-120644629 ATGTCTCAGGAGGAGGAGGAAGG + Intronic
1090013155 11:123062515-123062537 CGGAAAAAGGAGGAGGAAGAGGG + Intronic
1090401749 11:126453681-126453703 CTGGGAAGGGAGGAGGCGGAGGG - Intronic
1090805370 11:130198924-130198946 CTGTTCAAGGAGGAGGACAAGGG - Intronic
1090862449 11:130666130-130666152 AAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1090976841 11:131686514-131686536 GAGGAAGAGGAGGAGGAGGAAGG + Intronic
1091263133 11:134249699-134249721 CTGTAAAAGGGGGATGGGGTGGG + Intronic
1091413506 12:259970-259992 ATGGAAAAGAAGGAGGAAGATGG - Exonic
1091632810 12:2174956-2174978 TAGGAAGAGGAGGAGGAGGAGGG + Intronic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1092037738 12:5353557-5353579 ATATAAAATGAGCAGGAGGAAGG + Intergenic
1092041241 12:5386542-5386564 GAGGAAAAGGAGGAGGATGAAGG - Intergenic
1092330021 12:7577794-7577816 CTTTAAAAGCAAGAGGCGGAAGG - Intergenic
1092386904 12:8042751-8042773 CATTGAAAGGAGGAGTAGGAAGG + Intronic
1092662140 12:10750018-10750040 CTGTAAAATGAGGAAGAGAATGG + Intergenic
1092843337 12:12562943-12562965 CGGGAGGAGGAGGAGGAGGAGGG - Intergenic
1092914120 12:13174072-13174094 CTCTAAATGGAAAAGGAGGAAGG - Intergenic
1093084579 12:14852466-14852488 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1093151345 12:15625441-15625463 CTGTAAAAGGAGCAGAAAAATGG - Intronic
1093271768 12:17071572-17071594 GAGTAATAGGAGGAGGAGAAGGG - Intergenic
1093286258 12:17267927-17267949 CTGTCAGAGGACCAGGAGGATGG + Intergenic
1094030326 12:26004711-26004733 GAGGAAGAGGAGGAGGAGGAAGG + Intronic
1094129893 12:27063500-27063522 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1094353557 12:29553276-29553298 CGGTAAAATGGGGATGAGGAAGG + Intronic
1095537063 12:43261698-43261720 ATATACAAGGAGGAAGAGGAAGG + Intergenic
1095728372 12:45476809-45476831 CAGTCAAAGGAGGAAGAAGAGGG - Intergenic
1095785378 12:46103076-46103098 CTGAAAAAGGAGGACGAGAGAGG - Intergenic
1096004958 12:48162012-48162034 GTGTAAAAGTGGGAGGAGGTAGG - Intronic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096524221 12:52201034-52201056 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1096710505 12:53452221-53452243 GTGGAGGAGGAGGAGGAGGAAGG - Exonic
1097015864 12:55986896-55986918 CTGTAAAGGGGGGAGGGGGAAGG - Exonic
1097098110 12:56566094-56566116 CATTAAAAGGAGGGTGAGGATGG - Intronic
1097313127 12:58143037-58143059 CTGTAAAATGAGGATAATGATGG - Intergenic
1098035642 12:66299608-66299630 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1098065714 12:66614092-66614114 CTGAAAAAGGAAGAGGAGAAAGG - Intronic
1098106035 12:67069517-67069539 AGGAAGAAGGAGGAGGAGGAGGG - Intergenic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098504854 12:71237612-71237634 TAGAAAAAAGAGGAGGAGGAGGG - Intronic
1098568227 12:71959078-71959100 CAGTATAAGCAGGAAGAGGAGGG - Intronic
1098652422 12:72990106-72990128 CTAGAACAGGAGTAGGAGGAAGG - Intergenic
1099069923 12:78033466-78033488 TTATACAAGGAAGAGGAGGAAGG - Intronic
1099163849 12:79276968-79276990 GAGGAAGAGGAGGAGGAGGAGGG + Intronic
1099220746 12:79911186-79911208 CTGAAAAAAGAGTGGGAGGATGG - Intronic
1099284351 12:80697640-80697662 GAGTAAAAGAAGGAGGAAGAGGG - Intergenic
1099398439 12:82170982-82171004 AAGAAAAAGAAGGAGGAGGAGGG + Intergenic
1099600261 12:84726571-84726593 GAGGAAAAGGAGGAAGAGGAGGG + Intergenic
1100677657 12:96885852-96885874 GGGGAGAAGGAGGAGGAGGAAGG - Intergenic
1101064533 12:101005920-101005942 CTGGAAGAAGAGGAGGAGGCAGG - Intronic
1101391736 12:104307103-104307125 CAGTAAAATGATGAGGATGATGG + Intronic
1101432501 12:104638135-104638157 GGGGAAAAGGAGGAGGAGAAAGG + Intronic
1102119627 12:110429993-110430015 CTGGAGAAGTAGGAAGAGGAGGG - Intergenic
1102154143 12:110710927-110710949 CTTTAAAAGGAGGCTGAGGCAGG + Intergenic
1102167892 12:110820835-110820857 ACGAAGAAGGAGGAGGAGGAGGG - Intergenic
1102230406 12:111257776-111257798 CAGGAAGAGGAGGAGGAGGATGG - Intronic
1102418640 12:112786531-112786553 CTCTTAAAGGAGAAGGAGGAGGG + Intronic
1102649991 12:114434240-114434262 CTCTAAGAAGAGGAAGAGGAAGG + Intergenic
1102746220 12:115251269-115251291 AAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1102746235 12:115251366-115251388 GAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1102746249 12:115251457-115251479 GAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1102887670 12:116534065-116534087 GGGGAGAAGGAGGAGGAGGAGGG - Intergenic
1102893913 12:116583057-116583079 GGGTCAAAGAAGGAGGAGGAGGG + Intergenic
1102955898 12:117058898-117058920 CTGTGAAAGGCAGGGGAGGAGGG - Intronic
1102974966 12:117200150-117200172 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1103022639 12:117548324-117548346 GAGGAAAAGGAGGAAGAGGAGGG - Intronic
1103098237 12:118149116-118149138 ATGGAAAAGGGGGACGAGGAAGG - Intergenic
1103224218 12:119273008-119273030 CTGTAAAATGAGTCAGAGGAGGG + Intergenic
1103235392 12:119368216-119368238 GAGGAAGAGGAGGAGGAGGAGGG + Intronic
1103366747 12:120389463-120389485 CTGTTAGAAGAGGAGGGGGAGGG + Intergenic
1103413720 12:120730458-120730480 CTGTGTAGGGAGGAGGAGGCTGG + Intronic
1103525150 12:121562646-121562668 ATGGAGGAGGAGGAGGAGGAAGG + Intronic
1103774268 12:123354645-123354667 TTGTAAAATGAGGAGGAGATTGG - Intronic
1103921817 12:124403169-124403191 CTGTAAAACGGGGAGGTGGGGGG + Intronic
1104275659 12:127325035-127325057 ATGAAGATGGAGGAGGAGGAAGG - Intergenic
1104295492 12:127508144-127508166 CTGTAAAATGGGTAGGAGGATGG + Intergenic
1104316225 12:127704390-127704412 ATGGAAGAGGAGGAGGAGGGAGG + Intergenic
1104416665 12:128601461-128601483 CAGAGAAAGGAGGAGGAAGATGG + Intronic
1104707414 12:130957901-130957923 CAGTGAGAGGAGGACGAGGAAGG - Intronic
1104714336 12:131006466-131006488 CTGAAAAGGGAGGAGCAGGTGGG + Intronic
1104820278 12:131673061-131673083 ATGAAGGAGGAGGAGGAGGAGGG + Intergenic
1105524174 13:21160290-21160312 CTGACAAAGGAGGAGGAAGACGG + Intronic
1105698515 13:22915469-22915491 CTGCCAAGGGAGGAGGAAGATGG + Intergenic
1105722873 13:23134511-23134533 CTGGAAAAGGAGGAAGAGGAGGG + Intergenic
1105850184 13:24327716-24327738 CTGCCAAGGGAGGAGGAAGATGG + Intergenic
1106389962 13:29325504-29325526 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1107028683 13:35829181-35829203 CTGTGATAGGTGTAGGAGGAAGG + Intronic
1107106620 13:36650040-36650062 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1107242107 13:38248690-38248712 CAGAAGAAGGAGGAGGAGAAAGG - Intergenic
1107368299 13:39711096-39711118 ATGTTACAGGTGGAGGAGGAAGG - Intronic
1107826327 13:44332010-44332032 CTGACAAAGGAGGTGGTGGAGGG - Intergenic
1107871414 13:44749697-44749719 CTGTCAAGGGTGGAGGAGGATGG + Intergenic
1107938177 13:45362512-45362534 CTGAAAAGGGAGGAGATGGATGG - Intergenic
1109233951 13:59792784-59792806 CTGAAAAAGTAGGAGAATGAAGG - Intronic
1109505450 13:63295250-63295272 CTGTAAAAAGAGGAGCATAATGG + Intergenic
1109780107 13:67099276-67099298 ATGTAAAAGGATGTGGAGAATGG - Intronic
1110237768 13:73234342-73234364 CTGGAAAGGGAGGAGGAGGTGGG - Intergenic
1110807528 13:79774356-79774378 GAGGAAAAGGAGGAAGAGGAGGG + Intergenic
1111598521 13:90441991-90442013 GTGTGAAAGGAGAAGGAGGAGGG - Intergenic
1111874082 13:93871086-93871108 CTCTAAAATGAGGAAGAGGCAGG + Intronic
1112105758 13:96237395-96237417 CTTTGATAGGAGGAAGAGGAAGG - Intronic
1112182188 13:97094712-97094734 ATGTAAAAGGAGGAGAACAACGG - Intergenic
1112776979 13:102854976-102854998 CTGGGAAAGGAAGAGGTGGAGGG - Intronic
1113198655 13:107839216-107839238 CTGGAATAGGAGCAGGAAGATGG - Intronic
1113260430 13:108555742-108555764 TGGTAAGGGGAGGAGGAGGAGGG - Intergenic
1113403629 13:110018474-110018496 CATTGGAAGGAGGAGGAGGAGGG - Intergenic
1113751288 13:112778051-112778073 CTGTAGAAGAAGGAACAGGAAGG - Intronic
1113755015 13:112804462-112804484 CAGGAAAAGGAGGGGAAGGAGGG - Intronic
1113792244 13:113035011-113035033 CGGGAAAAGGAGGAAGAGCATGG + Intronic
1113909679 13:113836254-113836276 GAGGAAGAGGAGGAGGAGGAGGG + Intronic
1114422762 14:22598420-22598442 CTGGAAAAGGAAGAGCGGGAAGG - Intronic
1114441129 14:22748902-22748924 CTGTCAAAGGAGAAGGGGCACGG + Intergenic
1114660672 14:24341787-24341809 CTTTAAAAGAAGGAAGAGCAGGG + Intergenic
1114788436 14:25627874-25627896 AAGCAAAAGGAGGAGGAGAAGGG + Intergenic
1115094535 14:29618964-29618986 CTGGAGAATGAGGAGGAGGAAGG + Intronic
1115275594 14:31605788-31605810 GAGGAAGAGGAGGAGGAGGAAGG - Intronic
1115659133 14:35474601-35474623 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1116563556 14:46415551-46415573 CTCAGAAAGGAGGAGGAGAAGGG + Intergenic
1116665043 14:47764153-47764175 CAATAAAAGGATGAGGAGGCCGG + Intergenic
1117309668 14:54509418-54509440 GTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1117362550 14:54991346-54991368 CTCAAAGAGGAGGAGGAAGATGG - Exonic
1117372761 14:55093967-55093989 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1117446132 14:55805372-55805394 CTATGACAGGAAGAGGAGGAAGG - Intergenic
1117883827 14:60338422-60338444 CTCTAGAAAGAGGAGCAGGATGG + Intergenic
1117920122 14:60720902-60720924 CTGCCAAAGGAGCAGGAGGTAGG + Intronic
1118668454 14:68096482-68096504 ATCGAAAAGGAGTAGGAGGAAGG - Intronic
1118866723 14:69710213-69710235 ATGGAAGAGGAGGAAGAGGAGGG - Intronic
1119038252 14:71248795-71248817 CTTTCAAAGGAGGAGGAGGAGGG - Intergenic
1119119802 14:72064172-72064194 CTGGAAGAGGTGAAGGAGGAGGG + Intronic
1119476733 14:74934819-74934841 CTTTGAAAGGGAGAGGAGGAGGG + Intergenic
1119484287 14:74978005-74978027 GAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1119573029 14:75693119-75693141 CTGAAAGAGGAGAAGGAAGAAGG + Intronic
1119655202 14:76412537-76412559 GTTTGCAAGGAGGAGGAGGATGG - Intronic
1119679423 14:76580883-76580905 CTGTAACAGGAAGATGAGGCTGG + Intergenic
1119770198 14:77215823-77215845 CAGTAGAAGAAGTAGGAGGAGGG - Intronic
1120189258 14:81425324-81425346 CTTTAAGAGGCTGAGGAGGAGGG + Intronic
1120778627 14:88464987-88465009 CAGAAACAGGAGGAGGAGGGAGG - Intronic
1120899897 14:89566826-89566848 GTGGAGGAGGAGGAGGAGGAAGG - Intronic
1120990931 14:90376792-90376814 CTGTAAAAAGAGGAGCAGGAAGG - Intergenic
1121085011 14:91139251-91139273 GAGAACAAGGAGGAGGAGGAAGG - Intronic
1121265306 14:92598524-92598546 CTGTAAAAGGAGGGTGAGCATGG - Intronic
1121465166 14:94111181-94111203 CTGTAACATGCGGAGGAGGAGGG + Intronic
1122068108 14:99187776-99187798 CTCCAGGAGGAGGAGGAGGAAGG - Intronic
1122082414 14:99274709-99274731 GAGGAAAAGGGGGAGGAGGAGGG - Intergenic
1122172150 14:99885751-99885773 CAGTGAAAGGAGGAGGAAGAGGG + Intronic
1122804732 14:104250604-104250626 CTGGTAAAGGTGGAGGGGGAGGG + Intergenic
1122969791 14:105147889-105147911 CTGTAAGGAGAGGAGGAGGAGGG + Intronic
1123466023 15:20516469-20516491 TTATAAAAGGAGCAAGAGGAAGG - Intergenic
1123652091 15:22484570-22484592 TTATAAAAGGAGCAAGAGGAAGG + Intergenic
1123742511 15:23293430-23293452 TTATAAAAGGAGCAAGAGGAAGG + Intergenic
1123760814 15:23431056-23431078 TTATAAAAGGAGCAAGAGGAAGG - Intergenic
1124276747 15:28332445-28332467 TTATAAAAGGAGCAAGAGGAAGG - Intergenic
1124305953 15:28579161-28579183 TTATAAAAGGAGCAAGAGGAAGG + Intergenic
1124459631 15:29877610-29877632 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1124696577 15:31869352-31869374 CTGGAGGAGGAGGAGGAGGATGG + Intronic
1125024817 15:35019525-35019547 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1125511222 15:40293449-40293471 TGGGAAGAGGAGGAGGAGGAAGG + Intronic
1125672775 15:41485732-41485754 CTTTAAAAGGCCGAGGAGGGAGG + Intergenic
1125749455 15:42018872-42018894 CTATAAAAGTAGGAGTGGGAAGG - Intronic
1125762912 15:42109946-42109968 AGAAAAAAGGAGGAGGAGGAGGG - Intergenic
1125966741 15:43880891-43880913 CTGCAATGGGAGGAGGAGGCTGG + Intronic
1126052308 15:44697158-44697180 GAGGAGAAGGAGGAGGAGGAAGG - Intronic
1126230350 15:46316270-46316292 CTAGAACAAGAGGAGGAGGAGGG + Intergenic
1126236139 15:46386789-46386811 CTTAAAGAGGAGGAGAAGGAGGG + Intergenic
1126678917 15:51185537-51185559 CTGTCCTAGGAGGAAGAGGAAGG + Intergenic
1126764161 15:51996690-51996712 AAGAAGAAGGAGGAGGAGGACGG - Intronic
1126811457 15:52409927-52409949 CTGAAAGAGGAGAAGAAGGAAGG + Intronic
1127451279 15:59118781-59118803 CTGAAAAAGGAGGAGATGGCAGG - Intronic
1127489334 15:59447677-59447699 TGGTAAAAGAAGGAGGAAGAGGG - Intronic
1128054121 15:64687260-64687282 CTGTAAAAGGCTGGGGAGGTTGG - Intergenic
1128160521 15:65420746-65420768 CTGTAGAAGGAGAATGATGATGG - Intronic
1128328640 15:66741481-66741503 CTGTAAAATGAGGAGGAGGTGGG + Intronic
1128425950 15:67542704-67542726 CGGCGAGAGGAGGAGGAGGAAGG - Exonic
1128765108 15:70246569-70246591 CTGGCAAAGGAGGCGGAGAAGGG - Intergenic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1129156140 15:73719394-73719416 CCGTGAAAGGAGAAGGGGGAGGG - Intergenic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129862080 15:78870941-78870963 GTGGAAAAGGGGGATGAGGAAGG - Intronic
1130529305 15:84733991-84734013 AAGGAAAAGGAGGAGGAGAAGGG + Intergenic
1131090903 15:89624429-89624451 CTTTAGAAGGGGGTGGAGGAGGG - Exonic
1131139823 15:89968109-89968131 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1131387072 15:92016772-92016794 TCATAAAAGGAGGAGGAGGAGGG + Intronic
1131430147 15:92380754-92380776 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1131513589 15:93063288-93063310 CGTTCAAAGGAGGTGGAGGAGGG + Intronic
1131901070 15:97088539-97088561 ATGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131901083 15:97088587-97088609 AGGAAAGAGGAGGAGGAGGAAGG - Intergenic
1132028049 15:98419586-98419608 ATGGAGGAGGAGGAGGAGGAGGG + Intergenic
1132632192 16:923611-923633 CTTTAGAAGGACGTGGAGGAGGG + Intronic
1133228923 16:4357163-4357185 CAGCAAAAGAAGGAGGAGGTAGG - Exonic
1133392761 16:5422795-5422817 AAGAAAGAGGAGGAGGAGGAGGG + Intergenic
1133417290 16:5616550-5616572 AGGGAAGAGGAGGAGGAGGAGGG - Intergenic
1133417302 16:5616588-5616610 AGGGAAGAGGAGGAGGAGGAGGG - Intergenic
1133460674 16:5983927-5983949 GAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1133673856 16:8050913-8050935 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1134102789 16:11464225-11464247 CTGTAAAAAGGGAAGGAGAAGGG - Intronic
1134438082 16:14280096-14280118 CTTGAAAAAGAGGAGGACGAAGG + Intergenic
1134449392 16:14354212-14354234 AGGTAGAGGGAGGAGGAGGAAGG + Intergenic
1135229192 16:20689706-20689728 AAGTAAAAGGAGGAGGTGAATGG - Intronic
1135381186 16:21997417-21997439 CTGTCAGAGGAGGGGGAGGCAGG + Intronic
1135671852 16:24382261-24382283 GTGGAGAAGGAGGAGGGGGAGGG - Intergenic
1135750817 16:25057531-25057553 CTGTAAGGGGAGTAAGAGGACGG + Intergenic
1136081342 16:27854319-27854341 AAGGAAAAGGGGGAGGAGGAGGG + Intronic
1136110741 16:28062693-28062715 CCGCGAAAGGAAGAGGAGGAGGG + Intronic
1136363225 16:29795102-29795124 CTGTGAAAGCAGGCAGAGGAAGG + Intronic
1136612281 16:31373400-31373422 CTGGGGAAGGAGGAGGAGGCAGG + Intronic
1136911258 16:34146431-34146453 GGGTAAGAGGGGGAGGAGGAGGG - Intergenic
1137378903 16:47979490-47979512 TTGTAAAAGAGGCAGGAGGAGGG - Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137556975 16:49477040-49477062 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1137556991 16:49477122-49477144 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1137557129 16:49477565-49477587 GAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1137557150 16:49477671-49477693 GAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1137557161 16:49477739-49477761 GAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1137608440 16:49802577-49802599 GTGTCACAGGAGGAGGAGGAAGG + Intronic
1137757437 16:50913864-50913886 CTTTAAAATGAGAAGGTGGAGGG + Intergenic
1137827305 16:51510164-51510186 CTGACAAAGGAGAAGGAAGATGG - Intergenic
1137910385 16:52372417-52372439 CTCTACCAGGAGGAGGAGAAAGG + Intergenic
1138659084 16:58507322-58507344 CTGCAAAATGAGGAAGAGGTCGG + Intronic
1138913905 16:61439401-61439423 ATGTAAAAAGAGATGGAGGATGG + Intergenic
1138938410 16:61759432-61759454 CAGTAGTAGGAGGAGGAAGAGGG + Intronic
1139221685 16:65188914-65188936 TTGGAAAAGGAGGAGGAAAATGG - Intergenic
1139741808 16:69041698-69041720 CTATACAAGGTGGAGGAGAAGGG - Intronic
1140024277 16:71270258-71270280 GAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1140028686 16:71316076-71316098 CTGGAAAATGAGGATGAGAATGG + Intergenic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141148019 16:81545554-81545576 CTGTAGATGGAGGAGGATGCTGG - Intronic
1141158519 16:81613235-81613257 CTGATGAAGCAGGAGGAGGAAGG - Intronic
1142152007 16:88516795-88516817 TTGTAGAAGGAGAAGGGGGAGGG + Intronic
1142577826 17:921194-921216 CTGTAGGTGGAGGAAGAGGAAGG - Intronic
1142749695 17:1979812-1979834 CAGTCAAGGGGGGAGGAGGAGGG - Intronic
1142849128 17:2695855-2695877 CTGCGGGAGGAGGAGGAGGATGG + Intronic
1143101962 17:4509463-4509485 CTGTGAAAGGAGGAGAGGAAAGG + Intronic
1143200521 17:5110186-5110208 ATGAAAAAAGAAGAGGAGGACGG - Intronic
1143391543 17:6561692-6561714 GAGGAAGAGGAGGAGGAGGAAGG - Intergenic
1143729078 17:8870166-8870188 TGGCAGAAGGAGGAGGAGGAAGG - Intergenic
1143951391 17:10635478-10635500 CAGTATGAGGAGGAGCAGGAAGG - Exonic
1144406616 17:14958055-14958077 CTGGAAAAAGAATAGGAGGAAGG + Intergenic
1144647830 17:16987464-16987486 GTGGAGAGGGAGGAGGAGGAAGG + Intergenic
1144725515 17:17499987-17500009 CTGTGCAAGCAGGAGCAGGACGG + Intergenic
1144899143 17:18568326-18568348 CGTTCAAAGGAGGTGGAGGAGGG - Intergenic
1144968623 17:19093398-19093420 CAGGAAGAGGAGGAGGAGGGTGG + Intronic
1144979292 17:19158665-19158687 CAGGAAGAGGAGGAGGAGGGTGG - Exonic
1144988930 17:19219567-19219589 CAGGAAGAGGAGGAGGAGGGTGG + Intronic
1145281897 17:21474152-21474174 CTGTATAAGGAAGAAGAGGGTGG - Intergenic
1145395552 17:22491468-22491490 CTGTATAAGGAAGAAGAGGGTGG + Intergenic
1145985482 17:29043142-29043164 CGGCTAAAGGACGAGGAGGAAGG - Exonic
1146032349 17:29377011-29377033 CTGTAAAAGGATTAGCAGGATGG - Intergenic
1146200550 17:30853834-30853856 ATGTAACAGGAGGAAGAGTAGGG - Intronic
1146364516 17:32210688-32210710 CTGAGGGAGGAGGAGGAGGAGGG + Intronic
1146448763 17:32954887-32954909 ATGTAAAAGGAGGGTGATGAGGG - Intergenic
1146454576 17:32998923-32998945 CTGAATTAGGTGGAGGAGGATGG - Intergenic
1146586720 17:34089171-34089193 AAATAAATGGAGGAGGAGGATGG - Intronic
1146705124 17:34995750-34995772 CTGTCGGGGGAGGAGGAGGAGGG - Intronic
1147195360 17:38762921-38762943 AAGTAAAAGGACAAGGAGGATGG - Intronic
1147387387 17:40090442-40090464 GTGTGGAAGGAGGAGGTGGATGG - Intronic
1147675823 17:42204855-42204877 CATTAGAAGGCGGAGGAGGAAGG - Intronic
1147795885 17:43042462-43042484 CTGGAAAGGAAGGAGGAGAAAGG - Intergenic
1148097711 17:45064938-45064960 CTGAAGAAAGAGGAGGAGGGAGG - Intronic
1148249594 17:46064625-46064647 TTGGAGAGGGAGGAGGAGGAGGG - Intronic
1148271460 17:46265401-46265423 TAGGAAGAGGAGGAGGAGGAAGG - Intergenic
1148462376 17:47846119-47846141 CTGTGAGATGAGGGGGAGGAAGG + Exonic
1148647011 17:49225024-49225046 CAGCAGGAGGAGGAGGAGGAGGG + Exonic
1148787448 17:50152225-50152247 TAGGAAAAGGAGGAAGAGGATGG - Intergenic
1149114172 17:53071751-53071773 GAGGAAGAGGAGGAGGAGGAGGG + Intergenic
1149430383 17:56592776-56592798 CCGGCCAAGGAGGAGGAGGATGG + Intergenic
1149696968 17:58623714-58623736 CACAAATAGGAGGAGGAGGAAGG + Intronic
1149723639 17:58870113-58870135 CTGGAGGAGGAGGAGGAGGAAGG + Intronic
1150097376 17:62389266-62389288 CTGTAAGAGGTGGAGAAGGCAGG + Intronic
1150348323 17:64421879-64421901 CTTTAAAAGGAGGCCGAGGCAGG + Intergenic
1150643098 17:66962875-66962897 GAGGAAGAGGAGGAGGAGGAGGG + Intergenic
1150786250 17:68165353-68165375 CTGTAAAAGGAAGGAAAGGAAGG + Intergenic
1150929903 17:69573183-69573205 TTCTTAAAGGAGGAGGAAGAGGG - Intergenic
1151115838 17:71733916-71733938 CTACACAGGGAGGAGGAGGAGGG - Intergenic
1151218458 17:72593330-72593352 GTGTAAAAGGTGGAGGATGAAGG - Intergenic
1151660379 17:75515484-75515506 TTGGAAAAGGAGAAGGAGAAAGG - Exonic
1151808731 17:76423150-76423172 CAGGAAAAGGAGGAAGAGGTAGG + Intronic
1151825991 17:76524661-76524683 AGGTACGAGGAGGAGGAGGATGG - Intergenic
1152000435 17:77641917-77641939 CAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1152297549 17:79476942-79476964 GAAGAAAAGGAGGAGGAGGAAGG + Intronic
1152302032 17:79500640-79500662 CGGGAAAAGGAGAAGGGGGATGG - Intronic
1152305490 17:79518068-79518090 GGGGAAAAGGAGGAGGAGGGAGG - Intergenic
1152832313 17:82505202-82505224 CTGTAATAGGAGGCTGAGGCAGG + Intergenic
1152949655 17:83221544-83221566 TGGAAAGAGGAGGAGGAGGACGG + Intergenic
1152956313 18:44998-45020 AGGGAAGAGGAGGAGGAGGAGGG - Intergenic
1153147940 18:2055140-2055162 CTGTAAAAGGACAAAAAGGAAGG - Intergenic
1153185255 18:2478918-2478940 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1153440307 18:5110453-5110475 TTATAAAAGAAGCAGGAGGATGG + Intergenic
1153444753 18:5158513-5158535 ATGCAAAGGGAAGAGGAGGAGGG - Intronic
1153463974 18:5368215-5368237 GTGTGAAAGGAGAGGGAGGAAGG - Intergenic
1153815401 18:8786120-8786142 CAGAAAAAGGAGGGGGAGGGCGG - Intronic
1153820449 18:8827170-8827192 GGGTCAGAGGAGGAGGAGGACGG + Intronic
1153829399 18:8908354-8908376 CTTTAAAAGGAGGTGTAGGCCGG + Intergenic
1153938179 18:9950706-9950728 CTGTTAAAAGAGGAGTAGGGTGG - Intronic
1154032520 18:10766224-10766246 GAGGAACAGGAGGAGGAGGAGGG + Intronic
1155050949 18:22147281-22147303 TTGTACAATGAGGAGGAGAAGGG + Intergenic
1155066517 18:22273718-22273740 ATGGAGGAGGAGGAGGAGGAGGG - Intergenic
1155066654 18:22274124-22274146 GAGGAAGAGGAGGAGGAGGAAGG - Intergenic
1156170211 18:34474020-34474042 CTCTGGAAGGAGGAGGAGTAGGG - Intergenic
1156520647 18:37719934-37719956 CAACAAAAGGAGGAGGATGAAGG + Intergenic
1156585644 18:38428073-38428095 AGGGAAAAGGAGAAGGAGGAAGG + Intergenic
1156791769 18:40984132-40984154 GAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1156832960 18:41516872-41516894 CTGTATAAGCAGGAGAAGAATGG - Intergenic
1157150665 18:45214298-45214320 CCTTAAACAGAGGAGGAGGAAGG - Intronic
1157278439 18:46329323-46329345 CTGGAAAAGGTGGAAGTGGAGGG - Intronic
1157303667 18:46500101-46500123 ATGGAAAAGAAGGAAGAGGAGGG - Intronic
1157382031 18:47227207-47227229 GTGGAGGAGGAGGAGGAGGAAGG - Intronic
1157517287 18:48320139-48320161 CTGGAGAAGAAGGAGAAGGAGGG + Intronic
1157543338 18:48528838-48528860 CTGTAAAATGAGAATGATGATGG + Intergenic
1157775350 18:50390682-50390704 GAAAAAAAGGAGGAGGAGGAAGG - Intronic
1157867107 18:51196977-51196999 CTGGAAGAGGACGAGGAGGAGGG - Exonic
1158035741 18:53027738-53027760 CTGTAAAAGAAGTTGGAGGCTGG - Intronic
1158096434 18:53777542-53777564 CAGTAAAAGGAGTACCAGGAGGG - Intergenic
1158375085 18:56854498-56854520 CCATAAAAGGCCGAGGAGGACGG - Intronic
1158968933 18:62648268-62648290 CTGAAAAAGGAGGCGTTGGAAGG - Intergenic
1159453304 18:68629859-68629881 CTTTGAAAGGCCGAGGAGGATGG + Intergenic
1159517675 18:69478401-69478423 GAGAAAAAGGAGGAGAAGGAAGG - Intronic
1159657770 18:71053012-71053034 ATGAAATAGGAGGAGGACGAAGG - Intergenic
1160231357 18:77052037-77052059 CTGGAAGAGGATGAGGAGGCTGG + Intronic
1160278804 18:77466887-77466909 CAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1161437164 19:4270529-4270551 CTGAAAAAGGGGGAGGGGGGTGG + Intergenic
1161509544 19:4662919-4662941 CTGGGGTAGGAGGAGGAGGAAGG - Intronic
1161509589 19:4663113-4663135 CTGTAGAATGAGGATGAGGTGGG - Intronic
1161509719 19:4663640-4663662 CTGTAGAATGAGGATGAGGTGGG - Intronic
1161635117 19:5383652-5383674 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1161800575 19:6415101-6415123 AGGAGAAAGGAGGAGGAGGAGGG + Intronic
1161837037 19:6654802-6654824 CAGGAGGAGGAGGAGGAGGATGG - Intergenic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1162068535 19:8140073-8140095 CTGCAAAAGCAAGAGGAGGACGG + Intronic
1162176797 19:8836386-8836408 GAGGACAAGGAGGAGGAGGAAGG - Intronic
1162207989 19:9070330-9070352 CTCAGAATGGAGGAGGAGGAGGG + Intergenic
1162422716 19:10574962-10574984 GTGGAAAAGGAAGAGGTGGAGGG - Exonic
1162556955 19:11392984-11393006 CTGTGACAGGAAGAGGAAGAAGG + Intronic
1162563309 19:11430660-11430682 CTGGAAATGAAGGAGGAGGTGGG + Intronic
1162575124 19:11494915-11494937 CAGTAAAAGGCAGAGGAGGGCGG + Intronic
1162861301 19:13507316-13507338 CTAGAGAAGGAGGAGGTGGAGGG - Intronic
1162877303 19:13630188-13630210 CTGTCCCAGGAGGAAGAGGAGGG + Intergenic
1163105781 19:15122435-15122457 AGGGAAAAGGAGGAGGAGGAGGG + Intronic
1163361856 19:16851741-16851763 TTTGAAAAGGAGGAGGAGGAAGG + Intronic
1163387259 19:17007459-17007481 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1163463080 19:17450702-17450724 AAGGAAGAGGAGGAGGAGGAGGG - Intronic
1163612291 19:18307873-18307895 CTGGAGGAGGAGGAGGAGGTAGG + Intronic
1163629757 19:18412160-18412182 CTCTAAAAAAAGGAGGATGAGGG + Intergenic
1164211940 19:23106207-23106229 AAGAAAAAAGAGGAGGAGGAAGG + Intronic
1164486699 19:28662994-28663016 CAGTAAAAGTAGCAGTAGGAAGG - Intergenic
1164800087 19:31068957-31068979 CTGCCAGGGGAGGAGGAGGAAGG - Intergenic
1165431288 19:35774945-35774967 CTTTGAAAGGAGGCTGAGGAGGG + Intronic
1165730792 19:38143370-38143392 CACTGCAAGGAGGAGGAGGAAGG - Intronic
1165737243 19:38184476-38184498 CTGTAAAAGGGGGAGGACAGGGG - Intronic
1165821184 19:38677102-38677124 CTGAAGAATGAGGAGGAGGTAGG - Intronic
1166649981 19:44565718-44565740 GAGGAAAAGGAGGAAGAGGAGGG - Intergenic
1166652187 19:44582857-44582879 GAGGAAGAGGAGGAGGAGGACGG + Intergenic
1167056071 19:47112362-47112384 GAGGAAGAGGAGGAGGAGGAAGG - Intronic
1167123336 19:47532071-47532093 CTGGAAATGGAGGGGGAAGAAGG + Intronic
1167153919 19:47726554-47726576 GAGAAGAAGGAGGAGGAGGAGGG - Intronic
1167189961 19:47979169-47979191 ATGGAAGAGGAGGAGGAGGAGGG - Intronic
1167191288 19:47991750-47991772 GTGAAGAAGGAAGAGGAGGAGGG - Intronic
1167218942 19:48184734-48184756 CTGTAAAATGGGGATGAGAATGG - Intronic
1167383987 19:49153511-49153533 GAGGAAGAGGAGGAGGAGGAGGG - Exonic
1167572964 19:50301638-50301660 CTGTAGCAGGAGGGGAAGGAAGG - Intronic
1167686496 19:50960009-50960031 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1167732957 19:51272171-51272193 AAATTAAAGGAGGAGGAGGAAGG + Intergenic
1167775639 19:51552998-51553020 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1167969925 19:53182913-53182935 CTGGAAGAAGAGGAAGAGGAAGG - Exonic
1168082110 19:54017718-54017740 AAGTAAAAGGAGGAGGAGGGAGG - Intergenic
1168107021 19:54171975-54171997 CTGGAGGAGGAGGAGGAGGATGG - Exonic
1168133825 19:54337567-54337589 CTGTACAAGGAGGGGGCCGATGG - Exonic
1168136617 19:54356210-54356232 CAGGTAAAGGGGGAGGAGGAGGG - Exonic
1168297106 19:55382832-55382854 CTAGAAAAGGAGGAGTAAGAAGG - Intronic
1168307658 19:55444058-55444080 CTGTAAAATGGGGATAAGGATGG + Intergenic
1168471524 19:56644046-56644068 CAGTGAATGGAGGAGGAAGAAGG - Intronic
1168489661 19:56797644-56797666 GAGGAAGAGGAGGAGGAGGAGGG - Intronic
1168564014 19:57407658-57407680 CTTTGAAAGGTGGAGGTGGAAGG - Intronic
925073547 2:990491-990513 CTGTAATAGGAGAAAGAGGCAGG - Intronic
925190714 2:1881137-1881159 CTGTGAGAGGAGGAGGAGGCAGG + Intronic
925222084 2:2150062-2150084 GTGTAAAGGGAGGTGGAAGATGG - Intronic
925402566 2:3586028-3586050 AGGAAAAAGGAGGAGGGGGAAGG + Intergenic
925508471 2:4597081-4597103 AAGAAAAAGGAGGAGGAGGAAGG + Intergenic
925877428 2:8324935-8324957 CTGTAAAAGGAGGATAATAATGG - Intergenic
925899555 2:8498868-8498890 CTGCAAAATGAGGATGAGGATGG + Intergenic
926316775 2:11715802-11715824 ATGAAAATGGAGGAGGAGGATGG + Intronic
926321215 2:11749445-11749467 CTGTGGAAAGAGGAAGAGGAAGG - Intronic
927144919 2:20157272-20157294 CTTTGAAAGGAGCAGGAGGGAGG + Intergenic
927848717 2:26485682-26485704 CGGTAGAAGGTGGAAGAGGAGGG - Intronic
928098975 2:28423751-28423773 CTGTCAAATCAGGAGAAGGAGGG - Intergenic
928099432 2:28427317-28427339 CTGAGGAAGGAGGAGGAGAAGGG - Intergenic
928361339 2:30664515-30664537 CTGCTAAGGGAGGAGGTGGAAGG + Intergenic
928581133 2:32708767-32708789 GTGGAAAAGGGGGATGAGGAAGG + Intronic
929175001 2:38967300-38967322 CTGGAGAAGGGGGAAGAGGAAGG + Intronic
929237374 2:39620353-39620375 TTTTAAAAGGAAGAGAAGGAAGG - Intergenic
929444391 2:41991535-41991557 CTCCAAAAGGAGGAGTGGGAGGG + Intergenic
929828943 2:45332073-45332095 CTGTAACACCAGGAGGAGGAAGG + Intergenic
930364680 2:50424289-50424311 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
930589125 2:53306061-53306083 CTGAAAAATTGGGAGGAGGAAGG + Intergenic
930735685 2:54776208-54776230 GTGGAAAAGGAGGAGGAGAAAGG + Intronic
931163791 2:59723254-59723276 CTGGAAAAGGAGGAGGAAGTAGG + Intergenic
931236180 2:60414143-60414165 TTGGCAAAGGAGGAGGGGGAAGG - Intergenic
931459842 2:62441104-62441126 CTGTCCCAGGAGGAGAAGGATGG + Intergenic
931879264 2:66549890-66549912 CTGTGAATGCAGGAAGAGGAAGG + Intronic
932024498 2:68119793-68119815 CTGAAAGGGGAGGAGGGGGAAGG - Intergenic
932162376 2:69473260-69473282 CTGTAAAATGAAGAGGATGGTGG + Exonic
932757447 2:74418153-74418175 CTGGAGAAGGAGGAAGAGAAGGG - Intronic
933505830 2:83176129-83176151 TTGGATAAGGAGGAGGAAGAGGG - Intergenic
933789208 2:85870422-85870444 ATGAAAAAGGAGAACGAGGAGGG - Intronic
933981801 2:87556472-87556494 CTGCCAAGGGAGGAGGAGGGAGG + Intergenic
933995004 2:87661722-87661744 AAAGAAAAGGAGGAGGAGGAGGG + Intergenic
934653224 2:96104137-96104159 AAGGAAAAGGAGGAGGAGGAGGG - Intergenic
934744793 2:96752185-96752207 CTGTAGAAGGCTGAGGAGGGAGG - Intergenic
935151222 2:100438360-100438382 CAATAAAAGGATGAGGTGGAAGG - Intergenic
935192573 2:100790808-100790830 CTGGAAAAGGAGTATGATGATGG - Intergenic
935441554 2:103103919-103103941 ATGGAAAAGGAGGAAGAGAAAGG - Intergenic
935531701 2:104240509-104240531 GAGGAAGAGGAGGAGGAGGAGGG + Intergenic
936298854 2:111289191-111289213 AAAGAAAAGGAGGAGGAGGAGGG - Intergenic
936312035 2:111394345-111394367 CTGCCAAGGGAGGAGGAGGGAGG - Intergenic
936926541 2:117742713-117742735 CAGGAAGAGGAGGAGGAGCAAGG + Intergenic
937031862 2:118747518-118747540 CTGGAAGAGGAAGAGGTGGAGGG - Intergenic
937268638 2:120633139-120633161 CAGAAAAAGGAGGGGGAGGAGGG + Intergenic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
937627865 2:124064059-124064081 TTGTAAAAAGAGGAGAAGTATGG + Intronic
937856068 2:126672730-126672752 CTGTGAAAGGAGGTGGATAAGGG + Intronic
937887962 2:126913235-126913257 ATGAAAAAGGAGAAGGATGATGG - Intergenic
937905723 2:127051906-127051928 CTGTAAAAGGAGGAAGTGTCTGG + Intronic
938094716 2:128453990-128454012 CTGTAAGAAGAGGAGGATGCTGG + Intergenic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938221942 2:129576573-129576595 CTTGCAGAGGAGGAGGAGGAGGG - Intergenic
938581506 2:132650697-132650719 TTTTAAAGGAAGGAGGAGGAAGG - Intronic
938692298 2:133802713-133802735 CTTTGAAAGGAGGAGGGTGAGGG + Intergenic
938736594 2:134191669-134191691 GAGAAAGAGGAGGAGGAGGAGGG - Intronic
938757807 2:134396913-134396935 CTTGTAAAGGAGGAGGAGGCAGG + Intronic
939136065 2:138295781-138295803 AAGAAAAAGGAAGAGGAGGAGGG - Intergenic
939160098 2:138577271-138577293 CAGGAGGAGGAGGAGGAGGAGGG + Intergenic
939403107 2:141720493-141720515 CTGTAAAAGGTGCAAGATGATGG - Intronic
939505989 2:143047805-143047827 CTGTAATGGGAGGCTGAGGAGGG - Exonic
939966951 2:148619639-148619661 GGGAAAAAGGAGGAGGAGGAGGG - Intergenic
940011534 2:149060019-149060041 AGGGAGAAGGAGGAGGAGGAGGG + Intronic
940216128 2:151305390-151305412 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
940314717 2:152315772-152315794 CTCTAAAAAATGGAGGAGGAGGG - Intergenic
940344966 2:152619585-152619607 CTGGGAGAGGAGGAGGCGGAGGG - Exonic
940363232 2:152818081-152818103 ATGTAAGAGGAGGATGGGGAGGG + Intergenic
940471356 2:154104524-154104546 CTGGAAAAGGAGGTGAAGGAGGG - Intronic
940670157 2:156657699-156657721 CTGTACAGGGAGAAGGAGAAGGG + Intergenic
940719349 2:157264739-157264761 CTGGAGGAGGAAGAGGAGGAGGG + Intronic
940987383 2:160062669-160062691 TTGGGGAAGGAGGAGGAGGAGGG + Intergenic
941384991 2:164841542-164841564 CTGGAAAAGGAGGAGGAGCGGGG + Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942210424 2:173664232-173664254 TTGAAGAAGGCGGAGGAGGAGGG - Intergenic
942226270 2:173819076-173819098 CTGTAAAATGAGGAGCATAATGG + Intergenic
942241134 2:173964753-173964775 GGGAAAGAGGAGGAGGAGGAGGG - Intronic
942306393 2:174611499-174611521 TGGTATCAGGAGGAGGAGGAGGG + Intronic
942495944 2:176540185-176540207 CAGTAAAAGGCAGAAGAGGAGGG + Intergenic
942496027 2:176541046-176541068 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
942507354 2:176657062-176657084 ATAGAAAGGGAGGAGGAGGAGGG + Intergenic
942521761 2:176811424-176811446 CTAGAAGATGAGGAGGAGGAGGG - Intergenic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
943218704 2:185075782-185075804 ATGTAGAATGAGGAGGAGGAGGG + Intergenic
943269718 2:185783624-185783646 CTGTAAAAGATGCAGAAGGAAGG + Intronic
943726341 2:191255475-191255497 GTGTTAAAGAATGAGGAGGATGG + Intronic
943764626 2:191647428-191647450 GTGTAAAAGTGGGAGGAGCAGGG + Intergenic
944537483 2:200725458-200725480 CTGTCAAAGGGTGAGGGGGAGGG - Intergenic
944636090 2:201677452-201677474 CTGTGAAAGAGTGAGGAGGAAGG - Intronic
945257335 2:207813493-207813515 GAGGAGAAGGAGGAGGAGGACGG + Intergenic
945814979 2:214593701-214593723 TTTTAAAAGGAGAATGAGGAAGG + Intergenic
945863327 2:215148645-215148667 CTGTAAAAGGAGTGAGAGTAGGG + Intergenic
946147513 2:217742132-217742154 CTGGAAAAGGAGGATGGTGATGG - Intronic
946162005 2:217841164-217841186 CTGGAAAGGGAGAAGGGGGAAGG + Intronic
946313614 2:218896261-218896283 AGGGAAAAGTAGGAGGAGGAAGG + Intronic
946629676 2:221653437-221653459 CTGTCAAGGGAGGAGGAGTCAGG + Intergenic
946689600 2:222300376-222300398 CTGTCAAAGGAGGTGGGGGAGGG - Intronic
946693067 2:222324099-222324121 CTGTAAAATGAGGATAAGGGTGG + Intergenic
946740106 2:222792868-222792890 GTGAAGAAGGAGGAGGAGGAGGG - Intergenic
946756029 2:222948642-222948664 ATTTAACAGGAGGAGGAGAAAGG - Intergenic
946758873 2:222973451-222973473 AGGTAAAAGGCTGAGGAGGAGGG + Intergenic
946966139 2:225040419-225040441 CTTTAAAAAGAGGTGGGGGAGGG - Intronic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947795482 2:232891388-232891410 CTGGAAAGGCAGGATGAGGAAGG + Exonic
947929441 2:233951461-233951483 TTGTACAAGGAGTAAGAGGAAGG - Intronic
948091890 2:235302069-235302091 AGGGAAAAGGAGGAGGAGGGAGG - Intergenic
948599064 2:239097708-239097730 CTGAAAAAGGAGGAGGGCGTGGG + Intronic
948697620 2:239741006-239741028 ATCTCAAAGGAGGAGGAGGCTGG + Intergenic
948883588 2:240872315-240872337 GTGAACATGGAGGAGGAGGAGGG + Intronic
948995445 2:241576064-241576086 CTGGCAGGGGAGGAGGAGGAGGG - Intergenic
1169353161 20:4886293-4886315 TTTTAAAGGGAGGAGGAGGGAGG - Intronic
1170306354 20:14942441-14942463 AAGAAAAAGGAGGAGGAGAAAGG - Intronic
1171015826 20:21540910-21540932 CAGGAAATGGAGGAGGAGGTGGG + Intergenic
1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG + Intergenic
1171327266 20:24305569-24305591 GGGTTGAAGGAGGAGGAGGAAGG + Intergenic
1172060702 20:32185413-32185435 ATGTGAAAGGAGGTGGAAGAAGG + Intergenic
1172077572 20:32310954-32310976 GGGGAAGAGGAGGAGGAGGAGGG + Exonic
1172111235 20:32546358-32546380 CTGTAAAAGGAGGCTGAGAAAGG - Intronic
1172208182 20:33179574-33179596 CGGAGAAAGGAGGAAGAGGAGGG - Intronic
1172423958 20:34842391-34842413 CTGTGAAAGGAGGGGAAGGAAGG + Intergenic
1172474684 20:35227375-35227397 CTGGAGAAGGGGGAGGGGGAGGG + Intronic
1172811337 20:37650257-37650279 ATGAAAGAGGAAGAGGAGGAGGG - Intergenic
1173620163 20:44430338-44430360 CTGAAGAAGGAGGATGAGGTTGG - Exonic
1173900384 20:46583447-46583469 CAGTGAAAGGAGAAGCAGGAAGG + Intronic
1173920996 20:46744487-46744509 GTGGCAGAGGAGGAGGAGGATGG + Intergenic
1174736813 20:52972747-52972769 GTGGAGGAGGAGGAGGAGGAGGG + Exonic
1174808256 20:53623534-53623556 CAGCACGAGGAGGAGGAGGAGGG - Intergenic
1174869659 20:54171373-54171395 CTTTAAAAGAGGGTGGAGGAGGG + Intronic
1175452092 20:59077925-59077947 GGGAAGAAGGAGGAGGAGGATGG + Intergenic
1175564017 20:59958558-59958580 CTGAAAAGGGAGGAGCAAGATGG + Exonic
1175654012 20:60753105-60753127 TTTGAAAAGGAGAAGGAGGAAGG - Intergenic
1175657805 20:60787023-60787045 GGGAGAAAGGAGGAGGAGGAGGG - Intergenic
1175867324 20:62186231-62186253 CTTTAAAATGAGGATGATGAAGG + Intronic
1175959238 20:62626635-62626657 CTGGAAGAGCAGGAGGGGGAGGG - Intergenic
1176096613 20:63347272-63347294 CTGCAAAACGGGGAGGGGGATGG - Intronic
1176362059 21:6006177-6006199 CTCCAAAAGGAGGAGGAGGAGGG + Intergenic
1177115953 21:17087640-17087662 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1177121109 21:17138113-17138135 TACTAAAGGGAGGAGGAGGAAGG + Intergenic
1177507233 21:22034756-22034778 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1177600663 21:23308076-23308098 GTGTAAAAGAAGGAGGTGAAAGG + Intergenic
1178225849 21:30717538-30717560 AAGTAGAAGGAGGAGGAGAAGGG + Intergenic
1178226277 21:30722866-30722888 TTGTAAAAAGAGAATGAGGATGG - Intergenic
1178397119 21:32252417-32252439 AAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1178411204 21:32365068-32365090 CTGTGAGAGGAGGAGGAGACAGG + Intronic
1178493707 21:33070370-33070392 GTGGAGGAGGAGGAGGAGGAGGG - Exonic
1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG + Intergenic
1178881747 21:36455451-36455473 CTGTGGAAGGAGGGTGAGGATGG + Intergenic
1178940009 21:36897734-36897756 AGGTACAAGGAGGAGAAGGAAGG + Intronic
1179081804 21:38178535-38178557 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1179554498 21:42163590-42163612 CTGGATGAGGGGGAGGAGGAGGG + Intergenic
1179761459 21:43532368-43532390 CTCCAAAAGGAGGAGGAGGAGGG - Intronic
1180109507 21:45641614-45641636 TTAGAAAAGGAGGAGGAGAAGGG - Intergenic
1180228858 21:46414418-46414440 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
1180301617 22:11040954-11040976 GAGGAGAAGGAGGAGGAGGAAGG + Intergenic
1181467972 22:23120510-23120532 AGGTAAGAGGAGGAGCAGGAGGG - Intronic
1181481925 22:23205377-23205399 CCGTGAGAGGAGGAGAAGGAGGG - Intronic
1181693923 22:24583486-24583508 CTCTAAACGGAGGAGGAAGCAGG - Intronic
1181759881 22:25050995-25051017 GTGAAAGAGGAGGAGCAGGACGG - Intronic
1181829487 22:25548350-25548372 CTCTAAAAGAGGGAGAAGGAGGG + Intergenic
1181860334 22:25813133-25813155 AGGAAGAAGGAGGAGGAGGAGGG - Intronic
1182133217 22:27874423-27874445 CTGTCAAAGGAGGCGAAGGAGGG + Intronic
1182469148 22:30536691-30536713 TTGAACAAGGAGGAGGAGGAGGG + Intronic
1182663426 22:31941255-31941277 CTGTAAAACGGGAAGGAGGCCGG + Intronic
1182724864 22:32436389-32436411 GAGGAAGAGGAGGAGGAGGAGGG + Intronic
1182774210 22:32818972-32818994 GTGTCAGAGGAGGAGGAGGCAGG - Intronic
1182848080 22:33447766-33447788 CAGCACAGGGAGGAGGAGGAAGG + Intronic
1182864092 22:33586820-33586842 CTGTGAAAGGAGCAGAGGGAGGG - Intronic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1183598204 22:38824873-38824895 CTGGAGGGGGAGGAGGAGGAGGG - Intronic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183652998 22:39169754-39169776 CTGGAAAAAGGGGAGGAGGAGGG - Intergenic
1183957306 22:41388645-41388667 ATGTAAAAGGAGGAGGAATAAGG - Intronic
1184048187 22:41985289-41985311 CTGTGAGAGGAGGAGGAGGCTGG - Intronic
1184143337 22:42592782-42592804 CTGTAAAATGAGGTGGAGATCGG - Intronic
1184238925 22:43201536-43201558 ATAGAAAAGAAGGAGGAGGAAGG + Exonic
1184259904 22:43308758-43308780 GTAGAAAAGGAGGAGTAGGAGGG - Intronic
1184297832 22:43537036-43537058 ATGGAAAAGGTGGAGGAGGGCGG - Intronic
1184376584 22:44117328-44117350 CTGTAGAGGGTGAAGGAGGAGGG + Intronic
1184387135 22:44182635-44182657 CTGAAAAGGGAGGAAGAGGGAGG + Intronic
1184458793 22:44625739-44625761 CTGTAAAATGGGGATGAGGCTGG + Intergenic
1184574959 22:45356273-45356295 CTGTAGAGGGAGGAGGATGGTGG - Intronic
1184928400 22:47660741-47660763 ATGAAGAAGGAGGAAGAGGAGGG - Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1184989886 22:48160220-48160242 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1185029354 22:48433463-48433485 CTGTAAAATGAGGGTGACGACGG + Intergenic
1185055297 22:48575955-48575977 GAGGAAGAGGAGGAGGAGGAAGG + Intronic
1185057590 22:48588963-48588985 CTGTAATCGGAGGAGAAGGAAGG - Intronic
1185097158 22:48816554-48816576 GAGGAAGAGGAGGAGGAGGAGGG - Intronic
1185336163 22:50271734-50271756 CAGCTAAAGGAGGAGGAGGCCGG + Intergenic
949094318 3:67739-67761 AAGGAAGAGGAGGAGGAGGAAGG + Intergenic
949250082 3:1973143-1973165 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
949515442 3:4803117-4803139 CTGGAACAGGAGGAAGCGGATGG + Intronic
949711665 3:6877487-6877509 ATGTAAAAGCAGGAGTAGCAGGG - Intronic
949815203 3:8050876-8050898 CTGTAAATGGTGAAGGAGGGTGG + Intergenic
950562590 3:13743379-13743401 CTCCAAAAGGAGGAGGGAGAGGG - Intergenic
951393970 3:22141663-22141685 CTGGGGGAGGAGGAGGAGGAGGG + Intronic
951444686 3:22764930-22764952 CTGTAAAAGGACAAAGAGAAAGG - Intergenic
951556546 3:23926415-23926437 GAGCAAGAGGAGGAGGAGGAAGG - Intronic
951614744 3:24529896-24529918 CTGTAAAAGCAGGGTGAGGAGGG - Intergenic
951781521 3:26368581-26368603 CAGTAAAAGGAGGAAGTGGGGGG + Intergenic
951964986 3:28372024-28372046 CAGGAAGAGAAGGAGGAGGAGGG - Intronic
952700094 3:36318536-36318558 ATGGAGGAGGAGGAGGAGGAAGG - Intergenic
952711890 3:36439940-36439962 CTGTCAAAGAAGGGGGAAGAAGG - Intronic
952960439 3:38586042-38586064 CTGGGGAAGGAGGAAGAGGAGGG + Intronic
953054990 3:39380973-39380995 CTGTCAGAGCAGGAGGAGGTGGG - Intergenic
953230239 3:41058297-41058319 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
953230250 3:41058328-41058350 GTGGAGGAGGAGGAGGAGGAGGG + Intergenic
953419371 3:42742605-42742627 TTGTAAAAGGGAGAGGGGGAGGG - Intronic
953764057 3:45720515-45720537 CTAAAAAAGGAGGAAGAGAAGGG - Intronic
954111670 3:48437009-48437031 CAGTAGAAGGAAGAGGATGAGGG - Intronic
954130579 3:48558715-48558737 CTGCAAAAGGAGGATGAGGAAGG - Intronic
954594743 3:51814708-51814730 CTGCTTTAGGAGGAGGAGGAGGG - Intergenic
954876509 3:53806143-53806165 AGGGAAAAGAAGGAGGAGGAGGG - Intronic
954911375 3:54113689-54113711 TTGAAAGAGGAGGAGAAGGAGGG - Intergenic
955875922 3:63490295-63490317 CTGAAAAAGGAGGCAGAGGCTGG + Intronic
955935321 3:64097476-64097498 CATTAAGGGGAGGAGGAGGATGG + Exonic
956198803 3:66683940-66683962 AAGAAAAAGGAGGAGGAGGAGGG - Intergenic
956409490 3:68965033-68965055 GTGTAAAACTAGGAGGATGAGGG + Intergenic
956975148 3:74570206-74570228 ATGTATATGGAGGGGGAGGAGGG + Intergenic
957267162 3:77982567-77982589 CTGTGAAAGGAGCCGGGGGAGGG - Intergenic
957666770 3:83241972-83241994 CTGGAAATTGAGGAGGAAGAAGG + Intergenic
957772185 3:84708045-84708067 CTGTTTAAGGAGGAAGAGGCGGG - Intergenic
957867706 3:86045850-86045872 GTGTAAAATGAGGATGAGAATGG - Intronic
958157765 3:89776246-89776268 AAGAAAGAGGAGGAGGAGGAGGG - Intergenic
958195090 3:90234359-90234381 CTGTAAAGGTAAGAGCAGGATGG - Intergenic
958735755 3:98007628-98007650 CTGTAAAAGGAGAGGAATGATGG + Intronic
958971047 3:100610585-100610607 CTGGAAAAGGAGGACGTGGGAGG + Intronic
959034657 3:101346937-101346959 GTTTAAAAAAAGGAGGAGGAGGG + Intronic
959578213 3:107957703-107957725 CAAGGAAAGGAGGAGGAGGAGGG + Intergenic
960066155 3:113375221-113375243 GTGTTACAGGATGAGGAGGACGG + Intronic
960274255 3:115709227-115709249 CTGCAAAAGCAAGAGGAGGCAGG - Intronic
961508015 3:127384223-127384245 CTGGAGCAGGAGGAGGAGGTGGG + Intergenic
961646490 3:128395420-128395442 CATTCAGAGGAGGAGGAGGAAGG - Intronic
961747065 3:129070954-129070976 CTGTAAAATGGAGAGGAGGAAGG - Intergenic
961763543 3:129189874-129189896 CTTTGGAAGGTGGAGGAGGATGG - Intergenic
962051558 3:131821095-131821117 CTGAAGGAGGAGGAGGAGGTTGG + Intronic
962371177 3:134822006-134822028 GTTGAAAAGGAGGAGGAGGAAGG + Intronic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
963327355 3:143877153-143877175 CTCAAGATGGAGGAGGAGGAGGG - Intergenic
963590234 3:147247965-147247987 CTATAAAAAGAGGAGGTGTATGG + Intergenic
963783491 3:149510178-149510200 CTCTAAAAGGAAGAAGAAGAAGG + Intergenic
963796476 3:149635603-149635625 CGGAAGAGGGAGGAGGAGGAAGG + Intronic
963836828 3:150066690-150066712 GAGGAAGAGGAGGAGGAGGAGGG + Intergenic
963850679 3:150207511-150207533 CTGGAAGAGGAGGAGCGGGAAGG - Intergenic
964261912 3:154849023-154849045 GTGGAAAAGGTGGAGAAGGATGG + Intergenic
964374401 3:156035408-156035430 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
964452676 3:156826639-156826661 CCGGAAGAGGAGGAGGAGGAGGG - Exonic
964472791 3:157072159-157072181 AAAGAAAAGGAGGAGGAGGAAGG + Intergenic
965888840 3:173484607-173484629 CTCTAAAAGGAGAATGAAGATGG + Intronic
965994400 3:174862292-174862314 CTGTAACAGGAGTAGAGGGAGGG + Intronic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966889649 3:184397794-184397816 CTGGAAAAGGGGAAGAAGGAAGG + Intronic
966908496 3:184544545-184544567 GGGGAGAAGGAGGAGGAGGAGGG - Intronic
967349031 3:188491267-188491289 GTGATAAAGGAGGAGGAGGCTGG + Intronic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968161611 3:196431962-196431984 ATGATGAAGGAGGAGGAGGAGGG + Intronic
968293294 3:197555247-197555269 CCGGAGGAGGAGGAGGAGGAGGG + Intronic
968903590 4:3442054-3442076 CAGCAGGAGGAGGAGGAGGAAGG - Exonic
969692899 4:8715435-8715457 CAGAAAATAGAGGAGGAGGAAGG - Intergenic
970432653 4:16002918-16002940 ATTGAAAAGGAGGAAGAGGAGGG + Intronic
970506730 4:16738384-16738406 CAGGAAGAGGAGGAGGAGGAAGG + Intronic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971192305 4:24439183-24439205 CTCTTAAAGAAGGAGAAGGATGG - Intergenic
971366683 4:25983292-25983314 CTGGAAAAGGAGCAGGAAGGAGG + Intergenic
971633851 4:29031456-29031478 AGGGAAAAGGAGGAGGAGGAGGG - Intergenic
972568532 4:40290082-40290104 CTGTAAGGGGATGAGGCGGAAGG - Intergenic
972636239 4:40886533-40886555 CTGTAAAAGAATAAGGAGGAAGG + Intronic
973303585 4:48617630-48617652 GTGTTAAAAGAGGAGGAGGAGGG + Intronic
973571092 4:52240472-52240494 CTGAAAAAGAAGGAGGTGGAGGG - Intergenic
974032483 4:56788260-56788282 CATTAAAAGGGGGAGGAGGTCGG - Intergenic
974389624 4:61249429-61249451 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
975343610 4:73269122-73269144 CTTTAAAAGATGGAAGAGGAAGG - Intergenic
975495415 4:75030890-75030912 ATGTAAGAGGAGGAGGAGGAGGG + Intronic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
975767515 4:77684479-77684501 CAGTAACAGGAGGGGGAGGTAGG - Intergenic
975947082 4:79720059-79720081 ATGGAAAAGCATGAGGAGGAAGG - Intergenic
976295675 4:83468878-83468900 CAGTAACAGGAGTATGAGGAAGG + Intronic
976317471 4:83673826-83673848 CTGTGAAAGCAGGGAGAGGAGGG - Intergenic
976569612 4:86593814-86593836 CTTTGAAAGGAAGAGGAGAATGG - Intronic
977984092 4:103361220-103361242 CTGAAACAGGAGGAAGAGCACGG - Intergenic
978128982 4:105170942-105170964 GTGTAGAAGGAGGAGGAAGTTGG - Intronic
978449901 4:108820893-108820915 AGGCAAAAGGAGGAGTAGGAAGG + Intronic
978792334 4:112675814-112675836 CTGTAAAAGAAGGATGCAGATGG - Intergenic
978957696 4:114634425-114634447 CTCTCCAAGGAAGAGGAGGAGGG + Intronic
979481189 4:121219327-121219349 GAGGAAAAGGAGGAGGAGGGAGG - Intronic
979483413 4:121244239-121244261 TTGTAAAAGAAGGGGGAGAATGG - Intergenic
979654729 4:123179207-123179229 ATCTAGAAGGAGGAGTAGGATGG + Intronic
980156447 4:129113792-129113814 GAGCAAAAGGAGGAGAAGGAGGG - Exonic
981025053 4:140069476-140069498 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981025068 4:140069537-140069559 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981123864 4:141083410-141083432 GTAGAAAAGGAAGAGGAGGAGGG - Intronic
981184588 4:141785970-141785992 CAGGAAGAGGAGGAGGAGGGGGG - Intergenic
981295430 4:143125856-143125878 CTCTGGAAGGTGGAGGAGGAAGG - Intergenic
981468702 4:145103676-145103698 CTGAAAAAGGGGAAGCAGGATGG - Intronic
981655212 4:147105086-147105108 CTGTAAAAGGAGAAGGGTAAGGG - Intergenic
981737222 4:147965519-147965541 TTTTAAAAGGAGGAGGAAAAGGG - Intronic
981935073 4:150230454-150230476 GGGTAAAATGAGGAGCAGGAAGG + Intronic
982116616 4:152103731-152103753 CTGGGGCAGGAGGAGGAGGAGGG - Intergenic
982764250 4:159325806-159325828 CTGGAAAAGGAAGAGGAAGTAGG + Intronic
983021663 4:162684416-162684438 CTGAAAGAGGAGGGGAAGGAAGG + Intergenic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
983919821 4:173333856-173333878 CGGGAGGAGGAGGAGGAGGAGGG - Intronic
985031392 4:185794260-185794282 ATGGAGAAGGAGGAGGAGGGAGG + Intronic
985168343 4:187121810-187121832 AAGTAGAAGGAGGAAGAGGAGGG + Intergenic
985322466 4:188730140-188730162 CCGCTAAAGGAGGAGGAGGCTGG + Intergenic
985440433 4:189979843-189979865 AGGGAAGAGGAGGAGGAGGAGGG - Intergenic
985573984 5:665297-665319 CTGCAAGAGGAGCAGGAGGAAGG + Intronic
986468506 5:8050689-8050711 CTGTATAAGAAGGAGAAGGAAGG + Intergenic
986806535 5:11313228-11313250 CTGCTCAGGGAGGAGGAGGAGGG - Intronic
987225692 5:15838663-15838685 GGGTAAAAGAAGGAGGAGGTAGG - Intronic
987225810 5:15840352-15840374 TTGGAAAAGAATGAGGAGGAGGG - Intronic
987495652 5:18641020-18641042 ATTTAAAAGGGAGAGGAGGACGG + Intergenic
987675350 5:21066177-21066199 TTGTAAAAGCAGGAGGAAGAGGG - Intergenic
988117691 5:26918996-26919018 GTGGAAGAGGAGGTGGAGGAAGG + Intronic
988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG + Intergenic
989384023 5:40836854-40836876 CCTTAAAAGTAGGAGAAGGATGG - Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
989633208 5:43508991-43509013 TTGTAAAAGGAGGCTGAGGCAGG + Intronic
989764022 5:45057715-45057737 ACTTAAATGGAGGAGGAGGATGG - Intergenic
990106968 5:52276682-52276704 GTGGAAAAGGAAGAGGAAGATGG - Intergenic
990550741 5:56875623-56875645 GTGGAAAAGGAGGATGAGGAAGG - Intronic
991019579 5:61965870-61965892 CTGTCAGAGGAGTAGGATGAGGG + Intergenic
991116140 5:62957709-62957731 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
991398488 5:66229125-66229147 GTTGAGAAGGAGGAGGAGGAGGG + Intergenic
991436197 5:66598369-66598391 CTGTAAAAGGAGGAGCTTCAAGG + Intronic
991631222 5:68657995-68658017 CTGGGAAAGGGGGAGCAGGAAGG + Intergenic
991726917 5:69545011-69545033 CTGCAAAGGGAAGAGCAGGAAGG + Exonic
991868040 5:71082863-71082885 CTGCAAAGGGAAGAGCAGGAAGG - Intergenic
991960058 5:72035354-72035376 CTTTGAAAGAAGGAGGAGGAGGG - Intergenic
992009368 5:72511526-72511548 CTGTAAAAAGGGCAGGGGGATGG - Intergenic
992181994 5:74206596-74206618 CTGTGAACAGAGGAGGAGGGAGG - Intergenic
992278567 5:75148341-75148363 CTCCATAAAGAGGAGGAGGAAGG + Intronic
992349716 5:75916396-75916418 GTGGAGGAGGAGGAGGAGGAAGG - Intergenic
992561797 5:77959392-77959414 TTTTAAAAGGTGGAAGAGGAGGG - Intergenic
992912667 5:81412601-81412623 ATGAGAATGGAGGAGGAGGAGGG - Intergenic
993248267 5:85480397-85480419 CTGTTAAAAGTGGAGGAAGAAGG - Intergenic
993364170 5:87016566-87016588 CTGTAAAAAGAGAAAGAAGAAGG + Intergenic
993554961 5:89325253-89325275 CTGATAAAGGAGGAAGTGGAAGG - Intergenic
993840903 5:92877149-92877171 CTGGGAAAGGAGGAAGAGCATGG - Intergenic
994497794 5:100535577-100535599 CAGCAACAGCAGGAGGAGGACGG - Exonic
994681024 5:102887941-102887963 CTCTAAAAGGTGGAGGATGCGGG - Intronic
994825392 5:104707621-104707643 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
994976780 5:106818379-106818401 CAGGTAAAGAAGGAGGAGGAAGG - Intergenic
996116461 5:119625430-119625452 CAGAAAGAAGAGGAGGAGGAGGG - Intronic
996282178 5:121743222-121743244 CTTTAAAAAGAGGAGGATAATGG + Intergenic
997093682 5:130886386-130886408 CAGAAAAGGGAGGGGGAGGAGGG - Intergenic
997475066 5:134138036-134138058 CTGAAAAATGAGAAGGAGGGTGG - Intronic
997619530 5:135276564-135276586 GAAAAAAAGGAGGAGGAGGAAGG - Intronic
998157653 5:139795760-139795782 CTGGAGGAGGAGGAGGAGGGAGG - Intergenic
998171237 5:139873033-139873055 AAGTGAGAGGAGGAGGAGGAGGG + Intronic
998194767 5:140058775-140058797 GAGGAAAAGGAGGAAGAGGAAGG - Intergenic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998227533 5:140338636-140338658 CTGCAAAGGGAGGGGGAGGTAGG - Intronic
998359582 5:141573650-141573672 CGGGAAATGGAGGAGGTGGAGGG + Exonic
998611516 5:143694313-143694335 TTTAAAAAGGAGGAGGAGGAGGG - Intergenic
998675590 5:144404156-144404178 CTGGAAAAAGAGTAAGAGGATGG + Intronic
998901484 5:146860138-146860160 CTATAAAAGGAAAAGCAGGATGG - Intronic
999267272 5:150275076-150275098 GTGCAGAAGGATGAGGAGGAAGG + Intronic
999272283 5:150303415-150303437 CTGCAGAACGAGGAGGAGGGAGG - Intronic
999328971 5:150660120-150660142 CTGGAAGGGGAGGAGCAGGAGGG - Intergenic
999349348 5:150853096-150853118 CTGTAAAAGCAGTATGAAGAGGG - Intronic
999432636 5:151537276-151537298 GTGGAGGAGGAGGAGGAGGAGGG + Intronic
999880069 5:155852559-155852581 ATGTCAAAGAAGTAGGAGGATGG + Intergenic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001040912 5:168334546-168334568 CTGTAAATGGGGGTGGAGGGGGG - Intronic
1001132907 5:169079549-169079571 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1001132958 5:169079713-169079735 AGGGAAGAGGAGGAGGAGGAGGG + Intronic
1001312431 5:170620936-170620958 CAGTAAAGGGAGGAGATGGAAGG - Intronic
1001714427 5:173803147-173803169 CTGTAAAAGGAGGATAATAACGG + Intergenic
1001902189 5:175441877-175441899 CTGAAAAAGGAGGAGGCAGCTGG - Exonic
1002187155 5:177459677-177459699 GAGGAAGAGGAGGAGGAGGAAGG + Intronic
1002209050 5:177585099-177585121 CAGAGAAAGAAGGAGGAGGAAGG + Intergenic
1002715486 5:181224180-181224202 CGGGAGGAGGAGGAGGAGGACGG + Exonic
1002743887 5:181455356-181455378 TGGAAAGAGGAGGAGGAGGACGG + Intergenic
1002876903 6:1218765-1218787 TCATAAGAGGAGGAGGAGGAGGG + Intergenic
1002893471 6:1357748-1357770 GTTGAAAAGGAGGAAGAGGAGGG - Intergenic
1002934203 6:1657906-1657928 CTTTAAAAAGGGGAGGGGGATGG - Intronic
1003081525 6:3025251-3025273 CTTTAAAAGGAGGCCGAGGTGGG + Intergenic
1003099530 6:3166509-3166531 ATGTGAAAGGAGGAGGTAGAAGG - Intergenic
1003253066 6:4449443-4449465 GTGGAAAAGAAGGATGAGGAAGG + Intergenic
1003285667 6:4731889-4731911 CTGTGGAAGGAGGGGGAAGATGG + Intronic
1003487847 6:6595217-6595239 GGGGAAAAGGAGTAGGAGGAGGG + Intronic
1003707939 6:8555681-8555703 CTCTGTAAGGAGGAGGTGGAGGG - Intergenic
1003817626 6:9859942-9859964 ATGAAGAAGGAGGAGGAGAAGGG + Intronic
1003954710 6:11151013-11151035 CTGTGAAAAGAGGAGGTGGTGGG - Intergenic
1004097369 6:12570809-12570831 GTGTGAGAGCAGGAGGAGGAAGG + Intergenic
1004327530 6:14689204-14689226 GTGTCACAGGAGGAAGAGGAAGG + Intergenic
1004517403 6:16332123-16332145 CCCTAAATGTAGGAGGAGGATGG - Intronic
1004829178 6:19458805-19458827 TTTTTAAAGGAGGAGGAGGAAGG + Intergenic
1005002975 6:21261302-21261324 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
1005654429 6:27919534-27919556 CAGTATCAGGAGGAGAAGGAGGG + Intergenic
1005912931 6:30326785-30326807 CTGCGGAAGAAGGAGGAGGAGGG - Intronic
1006268855 6:32948909-32948931 GAGGAGAAGGAGGAGGAGGATGG - Intronic
1006474283 6:34244828-34244850 CAGGAGAAGGAGGAAGAGGAGGG + Exonic
1006698608 6:35953299-35953321 CTACAAAAAGAGGAGGAGCAAGG + Intronic
1006832919 6:36979648-36979670 CTGGAAGGAGAGGAGGAGGAGGG + Intronic
1007118628 6:39362297-39362319 CTAGAACAGCAGGAGGAGGAGGG - Intronic
1007254637 6:40520323-40520345 CTGTAGAAGGAGGTGCAGGGAGG + Intronic
1007477637 6:42129566-42129588 CAGTAACTGGAGGAAGAGGAAGG - Intronic
1007546527 6:42698711-42698733 CTGGAAAGGGAGGAGGAGAGGGG - Intronic
1007689130 6:43687451-43687473 CTTCACAAGGCGGAGGAGGACGG - Intronic
1007870683 6:45034145-45034167 CTGTTGGAGGAGGAGGAGGTAGG - Intronic
1007910656 6:45510864-45510886 CTGTAAAAGGTGAGGAAGGAGGG - Intronic
1008087806 6:47262741-47262763 ATGGACAAGGAGGAGCAGGAAGG + Intronic
1008288372 6:49682480-49682502 GAGGAATAGGAGGAGGAGGAGGG - Intergenic
1008290831 6:49713779-49713801 CCGTACTAGGAGGAGGAGGGAGG + Intergenic
1010941562 6:81924802-81924824 GTGGAGAAGGAGGAGGTGGAAGG + Intergenic
1011401972 6:86973158-86973180 ATTTAAAAGGAGAAGGTGGAGGG - Intronic
1011553309 6:88549277-88549299 AAGAAAGAGGAGGAGGAGGAAGG - Intergenic
1011742617 6:90377649-90377671 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1011955492 6:93019905-93019927 CAGTAAAAAAAGGATGAGGAAGG + Intergenic
1012165669 6:95948056-95948078 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1012981969 6:105840660-105840682 CTGTAGAAGGAGGGAGATGAGGG - Intergenic
1013639141 6:112056428-112056450 CATCAAAAGAAGGAGGAGGAGGG - Intronic
1013922215 6:115419799-115419821 CAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1014116753 6:117675487-117675509 CTGCCAAGGGAGGAGGAAGATGG + Exonic
1014119164 6:117703128-117703150 CTGTAAAATGAGGTGCATGAGGG + Intronic
1014268976 6:119314655-119314677 CTGTGCATGGAGGAGCAGGAGGG - Intronic
1014318329 6:119894464-119894486 GAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1014869973 6:126581949-126581971 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015995008 6:138988191-138988213 CTGTAAATGGCGGCGGAGGGAGG - Exonic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016671210 6:146710781-146710803 CTGAAAAATGAGGAGGTGTAGGG - Intronic
1017081495 6:150673663-150673685 CTGAAAAAGGAGGAGAGGGAGGG - Intronic
1017297204 6:152811910-152811932 AAAGAAAAGGAGGAGGAGGAAGG - Intergenic
1017688819 6:156942741-156942763 AAGCAATAGGAGGAGGAGGATGG - Intronic
1017922213 6:158882494-158882516 GTGTAAAAGCAGGAAGAGGCCGG + Intronic
1018090147 6:160339257-160339279 CTGTTAAAGGAGGAGCACCAGGG + Intergenic
1018380495 6:163254309-163254331 CTGATGAAGGGGGAGGAGGATGG + Intronic
1018411413 6:163552544-163552566 GAGTAAGCGGAGGAGGAGGAGGG + Intronic
1018638291 6:165884046-165884068 ATGTCAAAGCAGGTGGAGGAAGG + Intronic
1018982216 6:168610198-168610220 CTAAAACAGGAGGAGAAGGATGG + Intronic
1019140221 6:169938109-169938131 CTGTTAACGGAGGAGGCGGCGGG - Intergenic
1019248746 6:170728585-170728607 TGGAAAGAGGAGGAGGAGGACGG + Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019397533 7:830093-830115 CTGTTAAGGGGGAAGGAGGAAGG + Intronic
1019534270 7:1520375-1520397 CTGGAACAGAAGGTGGAGGAAGG + Intergenic
1019551837 7:1606927-1606949 CACGAAGAGGAGGAGGAGGAGGG - Intergenic
1020491300 7:8787482-8787504 CTGTAAGAGGGAGAGGACGATGG - Intergenic
1021530668 7:21641123-21641145 GTAGAAAAGGAGGAGGAAGATGG - Intronic
1021622461 7:22562254-22562276 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1021717121 7:23470396-23470418 AAGAGAAAGGAGGAGGAGGAGGG + Exonic
1022285392 7:28952192-28952214 CTAGAAAAAGAGGAGGAGAAGGG + Intergenic
1022454846 7:30549411-30549433 CTGTAAAATGAGGAGAATGATGG + Intronic
1022474080 7:30699158-30699180 CTGTAAAATGGGGAGAAGGCTGG + Intronic
1022488532 7:30799154-30799176 CTGTAAATGAAGGGGTAGGATGG + Intronic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1022498732 7:30869295-30869317 CTGATAGAGGAGGAGAAGGATGG + Intronic
1022568217 7:31424780-31424802 CTGTAAAAGGCCCAAGAGGACGG - Intergenic
1023055578 7:36287299-36287321 CTATATAAGAAGGAGGTGGAAGG - Intronic
1023225144 7:37961293-37961315 CAGTAAAAGCAGGAGGTGGCTGG - Intronic
1024109795 7:46133651-46133673 GTCAAAGAGGAGGAGGAGGAGGG - Intergenic
1024387810 7:48773613-48773635 CTGTCACAGGAGAAAGAGGATGG - Intergenic
1024677254 7:51647779-51647801 TTGGATGAGGAGGAGGAGGAAGG - Intergenic
1024846259 7:53646192-53646214 AAGAAGAAGGAGGAGGAGGAAGG - Intergenic
1025838421 7:65119419-65119441 AAGTAAAAAGAGGAGGGGGAGGG - Intergenic
1025878856 7:65513677-65513699 AAGTAAAAAGAGGAGGGGGAGGG + Intergenic
1025884651 7:65576562-65576584 AAGTAAAAAGAGGAGGGGGAGGG + Intergenic
1025898150 7:65722976-65722998 CTTTGAAAGGCTGAGGAGGATGG - Intergenic
1026159064 7:67852834-67852856 GAGAGAAAGGAGGAGGAGGAGGG + Intergenic
1026423241 7:70262431-70262453 CTTTAAAAGGCGGAGGGGGGTGG - Intronic
1026529522 7:71185046-71185068 AAGCAGAAGGAGGAGGAGGAGGG - Intronic
1026562443 7:71461763-71461785 CAGGAAAAGGCAGAGGAGGAGGG - Intronic
1026917452 7:74129504-74129526 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1026935172 7:74250599-74250621 CTGGAGACGAAGGAGGAGGATGG - Intronic
1027253504 7:76414682-76414704 AAAAAAAAGGAGGAGGAGGAGGG - Intronic
1027539357 7:79449254-79449276 CTTTGAAAGGAGCAGTAGGAGGG + Intronic
1027645317 7:80790324-80790346 AGGAGAAAGGAGGAGGAGGAAGG + Intronic
1027900657 7:84110130-84110152 ATGGAAAAGGAGGAGAAGGCTGG + Intronic
1028070824 7:86448032-86448054 AAAAAAAAGGAGGAGGAGGAGGG + Intergenic
1028246828 7:88489565-88489587 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1028888132 7:95957441-95957463 CAGCAGCAGGAGGAGGAGGAGGG - Intronic
1029308022 7:99635568-99635590 CTGGAAATGGGGGAGGGGGAAGG - Intergenic
1029537174 7:101163612-101163634 CTGTTCGCGGAGGAGGAGGACGG - Exonic
1029548070 7:101221830-101221852 AGGTCCAAGGAGGAGGAGGAAGG + Intronic
1029745718 7:102514757-102514779 CTGTGGAAGGAGGAGGACCAGGG + Intronic
1029763657 7:102613736-102613758 CTGTGGAAGGAGGAGGATCAGGG + Intronic
1029886461 7:103877810-103877832 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1030034445 7:105396689-105396711 GAGGAGAAGGAGGAGGAGGAAGG + Intronic
1030188822 7:106790725-106790747 CTCTAGGAGGAGGAGGAGGCTGG - Intergenic
1030322927 7:108188073-108188095 CTGTAACAGGAAGTGGGGGAGGG + Intronic
1030583098 7:111384308-111384330 AGGGAAAAGGAGAAGGAGGAGGG + Intronic
1030660758 7:112216714-112216736 CAGTAAAAGAAAGAGGAGGTAGG + Intronic
1030738305 7:113077617-113077639 CTGTGAAAGTGGGAGCAGGAAGG - Intergenic
1030867929 7:114722108-114722130 ATCCAAGAGGAGGAGGAGGAGGG + Intergenic
1031153795 7:118085523-118085545 TTGAAAATGGAGGAGGAGTAGGG - Intergenic
1031340046 7:120588708-120588730 CTCTAAAAGAGGGTGGAGGAAGG + Intronic
1031417581 7:121511246-121511268 CTGTAAGAGGAGGAGGGGGTAGG + Intergenic
1031458143 7:122010325-122010347 TTTTCAAAGGAGGAGGAAGAGGG + Exonic
1031943596 7:127815493-127815515 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1031994561 7:128221050-128221072 CTCACAAAGAAGGAGGAGGAGGG - Intergenic
1032473074 7:132192394-132192416 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1032523564 7:132563183-132563205 GAGGAAGAGGAGGAGGAGGAAGG - Intronic
1032548313 7:132761899-132761921 CTGCAAATGGAGGAAGAGAAAGG + Intergenic
1032869959 7:135974540-135974562 CAAAAAAAAGAGGAGGAGGAGGG + Intronic
1032962040 7:137046859-137046881 CAGAAGAAGGAGGAGGGGGAAGG + Intergenic
1033653049 7:143356394-143356416 CTGGAAATGGAGGACCAGGATGG - Exonic
1033839422 7:145356260-145356282 GAGGAAAAGGAGGAAGAGGAGGG - Intergenic
1033983968 7:147200063-147200085 GTGAGAAAGGAGGAGGGGGAGGG - Intronic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034446492 7:151116511-151116533 CTGGAGCAGGAAGAGGAGGAAGG + Intronic
1034459580 7:151191135-151191157 CTGTAAAAGGGGGAGGGGTGAGG - Intronic
1034746018 7:153524512-153524534 CTCTCCAAGGAGGAGGTGGAGGG + Intergenic
1034859339 7:154582536-154582558 AGGAAACAGGAGGAGGAGGAAGG - Intronic
1034945486 7:155259156-155259178 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034978901 7:155463399-155463421 AGGAAAAAGGAGAAGGAGGAGGG - Exonic
1035133310 7:156675680-156675702 CTGTGAACTGAGGAGGAGGCGGG - Exonic
1035194677 7:157206823-157206845 CTGTGAAAGCAGGAGCAGGATGG + Intronic
1035499299 8:78750-78772 TGGAAAGAGGAGGAGGAGGACGG - Intronic
1035722057 8:1799318-1799340 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1035970744 8:4245409-4245431 ATGCAAAGGGAGGAGGAGGCAGG + Intronic
1036039647 8:5060994-5061016 CTGAGCAAGGAGGAAGAGGAAGG - Intergenic
1036295217 8:7529242-7529264 CTGGAGAAGGAGGAGGAGAAGGG - Intergenic
1036327353 8:7791776-7791798 CTGGAGAAGGAGGAGGAGAAGGG + Intergenic
1036521684 8:9497769-9497791 CTAAAGAAGGAGGAGGAGGAAGG - Intergenic
1036621229 8:10425433-10425455 CTGCGAAGGGAGGAGGAGGAGGG + Intronic
1036900217 8:12664792-12664814 ACGTAAAAGAAGGAGGTGGAAGG + Intergenic
1037218182 8:16483870-16483892 GAGGAAGAGGAGGAGGAGGATGG + Intronic
1037218195 8:16483930-16483952 GAGGAAGAGGAGGAGGAGGATGG + Intronic
1037297683 8:17418408-17418430 GTGAAAAAGGAAGAGAAGGATGG - Intergenic
1037786973 8:21909088-21909110 GTGGAAAAAGAGTAGGAGGAGGG + Exonic
1037909542 8:22735704-22735726 CTGTCAAGAGAGGAGGAGGGTGG + Intronic
1038161364 8:25042162-25042184 AAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1038274734 8:26111454-26111476 CTGTAAATGGCTGAGAAGGAGGG - Intergenic
1038339542 8:26673923-26673945 GAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1038483642 8:27918788-27918810 GAGAAAGAGGAGGAGGAGGAGGG + Intronic
1038489280 8:27958290-27958312 CCGGAAGAGGGGGAGGAGGAGGG - Intronic
1039548679 8:38428255-38428277 CTGAAAGGGGAGGAAGAGGAGGG - Intronic
1039827273 8:41185192-41185214 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1040546442 8:48401626-48401648 CTGCAAAAGGGGTAGGAGGAAGG + Intergenic
1041216448 8:55606349-55606371 CTGGAGAAGGAGGAGGAGAGAGG - Intergenic
1041736030 8:61111332-61111354 CTCCAAAAGGAGGAAGAGAAGGG + Intronic
1041746916 8:61217356-61217378 CTTTAAGGGGAGAAGGAGGAGGG + Intronic
1042833155 8:73053434-73053456 ATGGGGAAGGAGGAGGAGGAGGG - Intergenic
1042984543 8:74568403-74568425 CTGGAAAAGAGGGATGAGGAAGG - Intergenic
1042987958 8:74604454-74604476 GTGGAGGAGGAGGAGGAGGAAGG + Intronic
1043137472 8:76546527-76546549 CTGTAAAAGGAGCAGGAACAGGG - Intergenic
1043185097 8:77138257-77138279 AATTAAGAGGAGGAGGAGGAAGG - Intergenic
1043192025 8:77237596-77237618 GAGGAAGAGGAGGAGGAGGAAGG - Intergenic
1043231554 8:77808581-77808603 TGGTAAAAGGAGGAGGAAGTTGG + Intergenic
1043385588 8:79744634-79744656 AAGTAAAAGGAGAAGGGGGATGG + Intergenic
1043386432 8:79752561-79752583 GAGGAAAAGGAGGAGGAAGAAGG + Intergenic
1043499505 8:80838670-80838692 CTGGAGGAGGAGGAGGAGGAGGG + Intronic
1043917368 8:85938490-85938512 CTGTTAAAGAAGAAAGAGGAAGG - Intergenic
1044727582 8:95205760-95205782 CTGTATAAGGATAGGGAGGATGG + Intergenic
1044817183 8:96125204-96125226 CTGAAAAGGGAGGTGGAAGAGGG + Intergenic
1044831147 8:96250675-96250697 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1044861162 8:96525317-96525339 CTGTTAAAAGAGGAGCAGAAAGG - Intronic
1044932020 8:97260133-97260155 CAGGAGAAGGAGGAGGGGGAGGG + Intergenic
1044953159 8:97452940-97452962 AAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1044968974 8:97601552-97601574 CTGTCAAAGGGAGAGGAGGTCGG + Intergenic
1044986602 8:97761509-97761531 GTGTCAAAGGTGGAGAAGGAAGG - Intergenic
1045130393 8:99145462-99145484 CTGGAAAAGAGGGAGGAGAAAGG - Intronic
1045727815 8:105196049-105196071 CTGTAAGAGGTGGAGTAGAATGG - Intronic
1046186616 8:110729759-110729781 AGGTAGAAGGAGGAGAAGGAGGG + Intergenic
1046399937 8:113691896-113691918 GAGAAAGAGGAGGAGGAGGAGGG - Intergenic
1046451841 8:114402904-114402926 GGGGAAGAGGAGGAGGAGGAGGG - Intergenic
1046632531 8:116635587-116635609 AGGGAAGAGGAGGAGGAGGAGGG - Intergenic
1046649685 8:116823854-116823876 CTGAAAAATGTGGAGGGGGATGG - Intronic
1046671857 8:117064797-117064819 CTGGGAGAGGAGGAAGAGGAGGG + Intronic
1047336918 8:123944886-123944908 ATGTAAAACAAGGAGAAGGATGG - Intronic
1047411851 8:124630402-124630424 CTGAAAGAGGAGGTGGAGAAAGG + Intronic
1047601977 8:126434724-126434746 CAGTTAAAAGAGGAAGAGGAAGG + Intergenic
1047614918 8:126556280-126556302 CTGTGGACGGGGGAGGAGGAAGG - Exonic
1047702565 8:127464240-127464262 TAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1047800209 8:128301286-128301308 AGGGAAAAGGAGGAGGTGGAGGG + Intergenic
1048210205 8:132448551-132448573 AGTAAAAAGGAGGAGGAGGAAGG + Intronic
1048285433 8:133137605-133137627 CTCTAAGAGGAGGAAGAGGAAGG + Intergenic
1048412086 8:134185696-134185718 CTGTACAAGTAGGTGGGGGAAGG + Intergenic
1048619806 8:136119219-136119241 CCATAAAGGGAGGATGAGGAGGG - Intergenic
1048836489 8:138523899-138523921 ATTTAAAAGGAGTGGGAGGATGG + Intergenic
1048951530 8:139500876-139500898 TTGTGAATGGAGGAGGAGGAAGG + Intergenic
1049230675 8:141479644-141479666 GTGTTTAAGAAGGAGGAGGAGGG + Intergenic
1049403689 8:142442375-142442397 CTGGGAGAGGAGGAGGAGGCAGG - Intergenic
1049508559 8:143016464-143016486 CTCAGAAAGCAGGAGGAGGAGGG + Intergenic
1049820366 8:144629757-144629779 CTGCGACAGGAAGAGGAGGAGGG + Intergenic
1049889428 9:54837-54859 CTGGAACAGAAGGAGGAGGGCGG - Intergenic
1050297777 9:4223479-4223501 CTCTAAAAGGAGGAGGCAGTGGG - Intronic
1051023930 9:12582668-12582690 CTGTAGATGGAGGAGGTGGGAGG - Intergenic
1051345183 9:16144971-16144993 CAGTGAAAGGAGGAGGCTGATGG - Intergenic
1051666978 9:19474823-19474845 ATTGATAAGGAGGAGGAGGAGGG - Intergenic
1051912134 9:22165154-22165176 TTGTTAAAGCAGGAGGAGGGAGG + Intergenic
1052324818 9:27206325-27206347 CTGTAAAGGGTGACGGAGGAAGG - Intronic
1052406837 9:28072033-28072055 ATGTAGAAGGAGGATGAAGATGG - Intronic
1055042966 9:71895220-71895242 CTGTAAATGGGGTGGGAGGAGGG - Intronic
1055195115 9:73581554-73581576 GAGAAAAAGGAGGAGCAGGAGGG - Intergenic
1055723123 9:79197909-79197931 CAGGATGAGGAGGAGGAGGAAGG - Intergenic
1055725751 9:79226394-79226416 TTTTAAAAGGAGAAGGAGGAAGG - Intergenic
1055919400 9:81442364-81442386 CAATAAATGGAAGAGGAGGAGGG + Intergenic
1056095378 9:83248059-83248081 CTCCAAAAGGAGGAGGAGCAGGG + Exonic
1056793027 9:89638414-89638436 CTGGAAGAGGAGGAGCAGGTAGG + Intergenic
1057069047 9:92080179-92080201 CTGTTAGAGTTGGAGGAGGAAGG - Intronic
1058561434 9:106233138-106233160 AGGAGAAAGGAGGAGGAGGAAGG - Intergenic
1058561453 9:106233233-106233255 AGGAAAAAGGAGGAGGAAGAAGG - Intergenic
1058561469 9:106233307-106233329 AAGAAAAAGGAGGAGGAAGAAGG - Intergenic
1058715963 9:107722206-107722228 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1058719085 9:107747341-107747363 ATGAGAAAGGAGGATGAGGAGGG + Intergenic
1058969147 9:110064205-110064227 CTACCTAAGGAGGAGGAGGAAGG + Intronic
1058986385 9:110212049-110212071 GTGTAAAAGGTGAAGGAGAAAGG - Intergenic
1059072406 9:111152755-111152777 TAGTAAGAGGAGGAGGAGAAAGG + Intergenic
1059166182 9:112078412-112078434 CTTTAACAGGGAGAGGAGGAAGG - Intronic
1059414605 9:114155350-114155372 CTATACAAGGAGGAGGGGGGCGG + Intergenic
1059712408 9:116881125-116881147 GTGGAAGAGGAGGAGGAGGAAGG + Intronic
1059840821 9:118213684-118213706 CTTTAAAGGGAGGAGAAGCAGGG - Intergenic
1060445280 9:123681444-123681466 CTGTAAAAACAGGGTGAGGAGGG + Intronic
1060991621 9:127853030-127853052 CTGTAAAATGGGGATGATGATGG + Intronic
1061541617 9:131280532-131280554 CTGAAAAATGAGAAAGAGGAGGG + Intergenic
1061613627 9:131764748-131764770 GTGGAGAAGGAGGAAGAGGAGGG - Intergenic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1062196445 9:135276716-135276738 CTGCAATGGGAGCAGGAGGAGGG - Intergenic
1062212923 9:135374183-135374205 CTGTGGAAGTAGGTGGAGGAGGG - Intergenic
1062451926 9:136619375-136619397 CTGAAGGAGGAGGAGGAAGAGGG + Intergenic
1062626728 9:137446458-137446480 CTGTAACAGGCTGAGGAGGCAGG + Intergenic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1203772083 EBV:54557-54579 CCGCCAAAGAAGGAGGAGGAGGG - Intergenic
1203704821 Un_KI270742v1:29992-30014 CTGTAGAAGAAGGAGGAACAGGG + Intergenic
1203609704 Un_KI270748v1:85849-85871 TGGAAAGAGGAGGAGGAGGACGG + Intergenic
1185499333 X:585095-585117 GTGGAGAAGGGGGAGGAGGAGGG + Intergenic
1185504960 X:625187-625209 GAGGAGAAGGAGGAGGAGGAGGG - Intronic
1185504972 X:625227-625249 GAGTAGAAGGAGGAGGAGGAGGG - Intronic
1185550651 X:980746-980768 GTGTCCATGGAGGAGGAGGAGGG + Intergenic
1185890426 X:3817024-3817046 CTCTAAAAAGAGGAGAAGGAGGG - Intergenic
1185954860 X:4478252-4478274 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1185957394 X:4506280-4506302 ATGTAAAAGGATGAGGGGGCTGG + Intergenic
1186004677 X:5056301-5056323 CTCTGAAAAGAGGAGGAGGCTGG - Intergenic
1186196468 X:7114375-7114397 TTGTAAGAAGAGGAGGAGGCTGG - Intronic
1186996820 X:15132331-15132353 CTGTAAGAGGATGAGAAGGCAGG - Intergenic
1187000600 X:15172907-15172929 CTGGAAAATGAGGATGAGAATGG - Intergenic
1187025747 X:15433932-15433954 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1187243085 X:17531143-17531165 CTCCAAAAGGAGGAAGGGGAAGG - Intronic
1187507536 X:19888762-19888784 CTGGAAATGGAGGAGGCTGAGGG + Intergenic
1188006366 X:25018130-25018152 CTGCACAAGGGGGAGGAGGGGGG - Intergenic
1188102126 X:26101718-26101740 TTTTAAAAGGAAGAGGAGAATGG - Intergenic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1188681539 X:33014193-33014215 CTGTAAAGGGAGTAGGATGTTGG - Intronic
1189197072 X:39161922-39161944 GAGAAAGAGGAGGAGGAGGAGGG - Intergenic
1189207503 X:39254437-39254459 CTAGAAAAGGAGGAGGAGGATGG + Intergenic
1189386340 X:40539811-40539833 CTGTAGGAGGAGGAGGAAGTGGG - Intergenic
1189824092 X:44899184-44899206 CTGTGGAGGGAGGGGGAGGAAGG + Intronic
1189830358 X:44966687-44966709 GTGTAATAGGGGGAAGAGGAAGG + Intronic
1189984671 X:46543662-46543684 CTGCCAAAGAAGGAGGAGCATGG - Intronic
1190101014 X:47523350-47523372 CTATCAAAAGAAGAGGAGGATGG + Intergenic
1190123389 X:47682579-47682601 GAGGAAGAGGAGGAGGAGGAAGG - Intergenic
1190171003 X:48111627-48111649 CTGTAAATGGAGAAGGAGCAGGG + Intergenic
1190183159 X:48211211-48211233 CTGTAAGTGGAGAAGGAGGGAGG + Intronic
1190497179 X:51037847-51037869 TAGGAAAAGGATGAGGAGGAGGG + Intergenic
1190777899 X:53568806-53568828 CTGTAGAAGCTGGAGGTGGAGGG + Exonic
1191103890 X:56760343-56760365 CAGCAAAAGGAGGGAGAGGAAGG - Intergenic
1191954782 X:66632437-66632459 CAGGAGGAGGAGGAGGAGGAGGG + Intronic
1192185181 X:68941831-68941853 AGGAGAAAGGAGGAGGAGGAAGG + Intergenic
1192562344 X:72135409-72135431 CTGTAAGGGGAAGAGAAGGAGGG + Intronic
1192635953 X:72817972-72817994 CTTCAAAAGGTAGAGGAGGAGGG - Intronic
1192645761 X:72902833-72902855 CTTCAAAAGGTAGAGGAGGAGGG + Intronic
1192847999 X:74925493-74925515 GAGTAGGAGGAGGAGGAGGAAGG - Intergenic
1194414003 X:93588352-93588374 CTGTAAAAGCAGGAAGAGAAAGG + Intergenic
1194958467 X:100208381-100208403 CTTTCAAGGGAGGAGGAGGGAGG - Intergenic
1194995405 X:100586707-100586729 CAGTAAGGGGAGGAGGAGTAGGG - Intronic
1195551849 X:106180442-106180464 CTCTCAAAGGAGTAGGAAGATGG - Intronic
1195696234 X:107669615-107669637 AAAAAAAAGGAGGAGGAGGAGGG - Intergenic
1195741424 X:108068555-108068577 CTGGAACAGGAGGAAGGGGAGGG + Intronic
1196812995 X:119643340-119643362 CTGTAAGTGATGGAGGAGGAAGG + Intronic
1196899204 X:120366657-120366679 GAGGAAAAGGAGGAGGAAGAGGG + Exonic
1196928705 X:120660065-120660087 GTGTAAAAGGAGGAGAGAGAGGG + Intergenic
1197804200 X:130383716-130383738 CAGTAAGGGCAGGAGGAGGAGGG + Intergenic
1197856798 X:130921751-130921773 GAGAAAAAGGAGGAAGAGGAAGG - Intergenic
1198039416 X:132835345-132835367 ATATAACAGAAGGAGGAGGACGG + Intronic
1198112407 X:133513514-133513536 CTGGAAAGGGAGGAGGAAGGAGG + Intergenic
1198229371 X:134674805-134674827 CTGTAAAGACAGGAAGAGGAAGG - Intronic
1198367000 X:135951218-135951240 CTGGAAACGAAGGATGAGGAAGG - Intergenic
1198504741 X:137290336-137290358 CTGTAAAAGGAAATGGAGGAGGG + Intergenic
1198767525 X:140094280-140094302 CTGAAAAAATATGAGGAGGAGGG + Intergenic
1198806551 X:140500668-140500690 ATGTAAAACAAGGAAGAGGAGGG + Intergenic
1199073867 X:143508978-143509000 ATCCAAAAGGAGGAGGACGAAGG - Exonic
1199117251 X:144007724-144007746 CTGGAACAGGAGGAAGAGAAAGG + Intergenic
1199190424 X:144963665-144963687 CTGTCAGAGGAGGAAGAAGAAGG - Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199594055 X:149492977-149492999 GCGCAAGAGGAGGAGGAGGAAGG + Intronic
1199715752 X:150506336-150506358 AAGGAAGAGGAGGAGGAGGAAGG - Intronic
1199849869 X:151717840-151717862 CTCTGAGAGGAGGAGGCGGACGG + Intronic
1199966551 X:152825105-152825127 CTGTAAAGGGATCAGGAAGATGG - Intergenic
1199966565 X:152825170-152825192 CTGTAAAGGGATCAGGAAGATGG - Intergenic
1200002511 X:153069324-153069346 AAGTAGGAGGAGGAGGAGGAAGG + Intergenic
1200005213 X:153080686-153080708 AAGTAGGAGGAGGAGGAGGAAGG - Intergenic
1200045101 X:153396949-153396971 CCGGAAAACGAGGATGAGGATGG - Intergenic
1200176287 X:154118824-154118846 CTGTAAAAAAAGGAAAAGGAAGG - Intergenic
1200207969 X:154331313-154331335 CTGTAAAATGAGCATGATGATGG + Intergenic
1200825534 Y:7635599-7635621 CTTTAAAATGAATAGGAGGATGG - Intergenic
1200887219 Y:8281671-8281693 CTGGCCAAGAAGGAGGAGGATGG - Intergenic
1200957400 Y:8964931-8964953 CTCTAAAATGAGTAGGAAGATGG + Intergenic
1201442246 Y:14020992-14021014 CTGTAAAAAAAGGGAGAGGAAGG - Intergenic
1201637600 Y:16142713-16142735 GAATAAGAGGAGGAGGAGGAAGG - Intergenic
1201739734 Y:17311109-17311131 CAGCAGCAGGAGGAGGAGGAGGG - Intergenic
1202234523 Y:22695496-22695518 CTTTAAAATGAATAGGAGGATGG + Intergenic
1202308636 Y:23500672-23500694 CTTTAAAATGAATAGGAGGATGG - Intergenic
1202562165 Y:26169914-26169936 CTTTAAAATGAATAGGAGGATGG + Intergenic