ID: 1128856713

View in Genome Browser
Species Human (GRCh38)
Location 15:71024043-71024065
Sequence ACTAGGTAGGGCCTCCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 553
Summary {0: 1, 1: 7, 2: 61, 3: 170, 4: 314}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128856705_1128856713 5 Left 1128856705 15:71024015-71024037 CCATCACTGCAGTAACCCATCCC 0: 1
1: 0
2: 1
3: 13
4: 159
Right 1128856713 15:71024043-71024065 ACTAGGTAGGGCCTCCCTGCAGG 0: 1
1: 7
2: 61
3: 170
4: 314
1128856707_1128856713 -10 Left 1128856707 15:71024030-71024052 CCCATCCCTGCTTACTAGGTAGG 0: 1
1: 0
2: 1
3: 12
4: 176
Right 1128856713 15:71024043-71024065 ACTAGGTAGGGCCTCCCTGCAGG 0: 1
1: 7
2: 61
3: 170
4: 314
1128856704_1128856713 24 Left 1128856704 15:71023996-71024018 CCAGAGACAGGAATGGCAGCCAT 0: 1
1: 0
2: 2
3: 29
4: 212
Right 1128856713 15:71024043-71024065 ACTAGGTAGGGCCTCCCTGCAGG 0: 1
1: 7
2: 61
3: 170
4: 314
1128856703_1128856713 25 Left 1128856703 15:71023995-71024017 CCCAGAGACAGGAATGGCAGCCA 0: 1
1: 0
2: 1
3: 24
4: 266
Right 1128856713 15:71024043-71024065 ACTAGGTAGGGCCTCCCTGCAGG 0: 1
1: 7
2: 61
3: 170
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128856713 Original CRISPR ACTAGGTAGGGCCTCCCTGC AGG Intronic
906954316 1:50359498-50359520 ACTGGGCAGGGCCTCCCGGCAGG + Intergenic
909047459 1:70727839-70727861 CCTGGGTGGGGCCTCCCTGCAGG - Intergenic
909303103 1:74038243-74038265 ACTGGGTGGGGTCTCCCTGCAGG + Intronic
910619332 1:89235965-89235987 ACTGGGCAGGGCCTCCACGCAGG - Intergenic
911435059 1:97845733-97845755 CCTAGGTCTGGCCTCCCTGAAGG - Intronic
912607577 1:111008150-111008172 ACTGGACAGGGCCTTCCTGCAGG + Intergenic
913332922 1:117682218-117682240 ACTAGCTATGGCCACACTGCTGG + Intergenic
914404627 1:147358396-147358418 ACTGGGTGGGGTGTCCCTGCAGG + Intergenic
914750837 1:150534046-150534068 GATGGGAAGGGCCTCCCTGCAGG - Intergenic
915046182 1:153018761-153018783 ACCAGACAGGGCCTCCCTGCAGG + Intergenic
915995427 1:160557911-160557933 ACTGGGTGGGACCTCCCTGCAGG + Intronic
916510419 1:165468046-165468068 ACTGGGAATGGCTTCCCTGCCGG + Intergenic
916594817 1:166233885-166233907 ACTGGGTGGGACCTCCCAGCCGG - Intergenic
916849005 1:168683916-168683938 ACTGGGTGGGGCCTCTCTGCAGG - Intergenic
917060549 1:171032987-171033009 ACTGGGTGGGGCTTCCCTGCAGG - Intronic
917269648 1:173258780-173258802 ACTGGGAAGGGTTTCCCTGCAGG + Intergenic
917305235 1:173617561-173617583 ACTGGGTGGGGCCTCCCTGCAGG + Intronic
917356426 1:174131173-174131195 ACTGGGCAGGGCTTCCCTGCAGG - Intergenic
917582354 1:176391794-176391816 ACTGGGTGGGGCCTCCCTGCGGG - Intergenic
917682745 1:177384593-177384615 ACTGGGCAGGGCTTCCCTACAGG - Intergenic
918168747 1:181975241-181975263 ACTGGGTGGGGCCTCCCTGCAGG + Intergenic
918697305 1:187560364-187560386 ACTGGGCAGGGCCTCCCTGCAGG - Intergenic
918802244 1:188986700-188986722 AGTGAGCAGGGCCTCCCTGCAGG - Intergenic
918943191 1:191027299-191027321 ACTGGGCAGGGCTTCCCTGCAGG + Intergenic
918955252 1:191199138-191199160 ACTGGGTAGGGCCTCCCTGCAGG + Intergenic
919031798 1:192251864-192251886 ACTGGGTGGGGCTTCCCAGCAGG - Intergenic
920766099 1:208835295-208835317 AATTGGTGGGGCCTCTCTGCAGG + Intergenic
921013080 1:211161911-211161933 ACCAGGTGGGGCCTCCCAACTGG - Intergenic
921918717 1:220642418-220642440 ACCAGGCAGGGCCTCCCTGCAGG + Intronic
924412346 1:243819425-243819447 ACTGGGCAGGGCCTCCCTGCAGG + Intronic
924629575 1:245724182-245724204 ACTGGGTGGGGCCTCCCTGTGGG + Intergenic
924952554 1:248898014-248898036 ACTGGGTGGGGCCTCCCTGTGGG + Intergenic
1063965242 10:11341319-11341341 ACTAGGTAGGTCTTTGCTGCAGG - Intergenic
1065196488 10:23270869-23270891 ACTGGGTGGGGCCTCCCTGCAGG + Intronic
1067923222 10:50480945-50480967 ACTGGGCAGGGCATCCCTGTGGG + Intronic
1068381143 10:56255172-56255194 ACCAGGTGAGGCCTCCCTGAAGG - Intergenic
1069370947 10:67747061-67747083 ACTGGGCAGGACCTCCCTGCAGG + Intergenic
1072361544 10:94664187-94664209 ACTGGGTGGGGCCTCCCTGCAGG - Intergenic
1072854824 10:98935983-98936005 ACCGGGCAGGGCATCCCTGCAGG - Intronic
1073716623 10:106115034-106115056 ACCGGACAGGGCCTCCCTGCAGG + Intergenic
1074022016 10:109594002-109594024 ACTAGGTGGGACCTCTCTGTGGG + Intergenic
1075230434 10:120671662-120671684 ACTGGGTGGGGCCTCCCTGCAGG + Intergenic
1076185137 10:128440795-128440817 ACTGGGTGGGGCCTCCATGTAGG + Intergenic
1077406225 11:2383659-2383681 ACCAGGCAGGGCCACGCTGCGGG - Intronic
1078691251 11:13582737-13582759 ACTGGATGGGGACTCCCTGCAGG + Intergenic
1079349394 11:19679927-19679949 AATAGGTAGGGCTCCCCTCCAGG - Intronic
1079426074 11:20343105-20343127 ACTGGGCGGGGCCTTCCTGCAGG + Intergenic
1079588047 11:22150057-22150079 ACTGGATGGGGCCTCCCTGAGGG - Intergenic
1079800292 11:24860227-24860249 ACTGGGTGGGGCTTCCCTGCAGG + Intronic
1080130878 11:28793017-28793039 ACTGGGCAGGGCTTCCCTGCAGG - Intergenic
1080214715 11:29827504-29827526 ACTGGGTGGGGCCTCCCTGCAGG + Intergenic
1080292582 11:30687895-30687917 ACTGGGCAAGTCCTCCCTGCAGG + Intergenic
1082746512 11:56968719-56968741 ACTGGGCGGGGCCTCCCTGTGGG - Intergenic
1082757483 11:57092283-57092305 ACTGGGTGGGGCCTCCCTGCGGG - Intergenic
1082993965 11:59234035-59234057 ACCAAGCAGGGCCTCCCTACAGG + Intergenic
1084604636 11:70165389-70165411 ATGAGGGTGGGCCTCCCTGCAGG + Intronic
1084945127 11:72634233-72634255 GCTGGGGAGGGGCTCCCTGCCGG + Intronic
1085335150 11:75687826-75687848 ACTAGCCAGGGCCTCCCTGCAGG - Intergenic
1086279762 11:85171888-85171910 ACTGGGTGGGGCCTCCCTGTGGG + Intronic
1087316997 11:96614828-96614850 ACTGGGCAGGGCCACCCTGCAGG - Intergenic
1087626645 11:100603703-100603725 ACTGGGCAGGACCTCCCAGCTGG + Intergenic
1088037426 11:105334406-105334428 ACTGGGCACGGCCTCCCTGTGGG + Intergenic
1088328755 11:108628726-108628748 CCTAGGTCTGGCCTCCCTGAAGG + Intergenic
1088383382 11:109221413-109221435 ACTGGGCGGGGCCTCCCTGTAGG - Intergenic
1088697734 11:112382814-112382836 ACTGGGCGGGGCTTCCCTGCAGG + Intergenic
1089783062 11:120887866-120887888 ACTGGGAGGGGCCTCCCTGAGGG + Intronic
1090307800 11:125705411-125705433 ACTAGGCAGGGCATCCCTGAAGG + Intergenic
1090425939 11:126607114-126607136 AGTAGCTAGGGCCTCCCAGGAGG + Intronic
1090734431 11:129598755-129598777 ACTGGGCAGGGCCTCCCTGCAGG + Intergenic
1091001559 11:131914025-131914047 ACAAGGAAGGGCTGCCCTGCTGG + Intronic
1091398573 12:169401-169423 AGGAGGGAAGGCCTCCCTGCAGG - Intronic
1092325521 12:7527561-7527583 ACTGGGTGGGTCCTCCCTGTGGG - Intergenic
1093340454 12:17967303-17967325 ATTGGGCAGGGTCTCCCTGCAGG - Intergenic
1093383336 12:18521463-18521485 ACTGGGCAGGGCCTCCCTGTAGG - Intronic
1094273760 12:28645808-28645830 ACCGGGCAGGGCCTTCCTGCAGG - Intergenic
1094275341 12:28668845-28668867 ACTGGGTGGGACCTCCCTGCAGG + Intergenic
1094694963 12:32809235-32809257 ACTGGGCAGGGCCTCCCTGTGGG - Intronic
1097421863 12:59390416-59390438 ACTGGGCAAGGCCTCCCTGCAGG + Intergenic
1097455722 12:59796315-59796337 AGTGGGCAGGGCCTCCCTGCAGG + Intergenic
1097516987 12:60618235-60618257 ACCAAATAGGGCCTCCATGCAGG + Intergenic
1097910603 12:64965561-64965583 ACTGGGTGGGACCTCTCTGCAGG - Intergenic
1098439665 12:70504473-70504495 ACTGGGTAAGGCCTCCCTGCAGG - Intergenic
1098764514 12:74469203-74469225 ACTGGGCAGGGCATCCCTGCAGG - Intergenic
1099590026 12:84575254-84575276 ACCAGGTGGGGGCTCCCTGTGGG + Intergenic
1099682358 12:85844518-85844540 AGTAGGTAGCTCCTCTCTGCAGG - Intergenic
1099684306 12:85865915-85865937 ACTGCGTGGGGCTTCCCTGCAGG - Intergenic
1099694229 12:85997766-85997788 GCAAGGTACGGCCTCCCTTCAGG + Intronic
1099707913 12:86180509-86180531 ACAAGGTACAGCCTCCCTCCTGG - Intronic
1100115112 12:91294646-91294668 ATCGGGCAGGGCCTCCCTGCAGG + Intergenic
1100941107 12:99723427-99723449 ACTGGGAGGGGCCTCCCTGCAGG + Intronic
1101187214 12:102292034-102292056 ACTGGGCAGGGCCTCCCTAAAGG - Intergenic
1103130659 12:118465924-118465946 ACATGGCAGCGCCTCCCTGCTGG + Intergenic
1105668451 13:22586555-22586577 ATTGGGTGGGGCCTCCCTGAAGG - Intergenic
1105829642 13:24152498-24152520 ACTGGGGAGGACCTCCCTGGTGG - Intronic
1107314789 13:39119651-39119673 ACCAGGCAAGGCCTCCCTGCAGG - Intergenic
1107661371 13:42643066-42643088 ACCAGGCAGGGCCTCCCTGTGGG - Intergenic
1108029160 13:46211184-46211206 ACTAGGTAGAGCTTCCTTCCAGG - Intronic
1108144683 13:47464016-47464038 ACTGGTTGGGGCCTCCCTGCAGG + Intergenic
1108173963 13:47773216-47773238 ACTGGGTGGGGCCTCCCTGCAGG - Intergenic
1108957802 13:56182821-56182843 ACTGAGTGGGGCCTCCCTGCAGG + Intergenic
1109097269 13:58134209-58134231 ACTGTGCAGGGCCTCCCTGCAGG - Intergenic
1109146867 13:58790502-58790524 ACTGGGCAGGACCTCCCTGTGGG - Intergenic
1110567129 13:76968004-76968026 ACTGGGTGGGGCCTCCCTGCAGG - Intergenic
1110790479 13:79581897-79581919 ACTGGGTGGGGCCTCCCTGCAGG - Intergenic
1110821826 13:79925937-79925959 ACCAGGCAGGGCCTCCCTGTGGG - Intergenic
1111200345 13:84927916-84927938 ACTGGGTGGAGCCTCCCTGCAGG + Intergenic
1111522804 13:89427738-89427760 ACTGGGCAGGACCTCCCAGCGGG - Intergenic
1112508412 13:99989103-99989125 GGCAGGTTGGGCCTCCCTGCGGG - Intergenic
1113910913 13:113840846-113840868 CCTGGGTAGGGCCCCCCTGCTGG + Intronic
1116221647 14:42095773-42095795 AATGGGTAGCGCCTCTCTGCAGG + Intergenic
1116231911 14:42228970-42228992 ACAGGGCAGGGCCTCCCAGCTGG - Intergenic
1116301432 14:43188470-43188492 ACTTGGCAGGACCTCCCTGAAGG + Intergenic
1116671305 14:47846223-47846245 ACTGGGTGGGGCATCCCTGTGGG + Intergenic
1116685688 14:48035820-48035842 ATTGGGTGGGGCCTCCCTGCAGG - Intergenic
1116977429 14:51131588-51131610 AGTGGGTGGGGCTTCCCTGCAGG + Intergenic
1117751049 14:58924190-58924212 ATTGGGCAGGGCCTCCCTGTGGG + Intergenic
1117829201 14:59733433-59733455 ACTAGGCGAGGCCTCCCAGCTGG + Intronic
1118478910 14:66144092-66144114 ACTTGGTGGGGCTTCCCTGCAGG + Intergenic
1118530694 14:66702075-66702097 ACTGGGTGGGGCTTCCCTGCAGG + Intronic
1119529890 14:75352647-75352669 GCCAGGTAAGGCCTCCCTGAAGG - Intergenic
1120368997 14:83607854-83607876 ACTGGGTGGAGCCTCCCTGAAGG - Intergenic
1120799128 14:88669521-88669543 ACTGTGCGGGGCCTCCCTGCAGG + Intronic
1121142419 14:91555072-91555094 ACTGGGCAGGGCCTCCCTGTGGG + Intergenic
1121429190 14:93874785-93874807 ACCAGGGAGGGCAGCCCTGCTGG - Intergenic
1121706805 14:96002391-96002413 ACTGGGTGGGGCCTCCCTGTAGG + Intergenic
1122906840 14:104805506-104805528 ACATGAGAGGGCCTCCCTGCAGG - Intergenic
1123885073 15:24718536-24718558 ACTGGGCAGGGCCTCCATGCAGG - Intergenic
1124046519 15:26155718-26155740 ACTGGGAAGGGCCTCCCTACAGG - Intergenic
1124196946 15:27639585-27639607 ACTGGGCGGGGCCTCCATGCGGG + Intergenic
1126219592 15:46197354-46197376 ACTAAGTAGAGCCTCTCTGTGGG - Intergenic
1126236749 15:46394654-46394676 ACTGGGCAGGGCCTCCCTACAGG + Intergenic
1126284577 15:46996523-46996545 ACTGGGTGGGGCCTCCCTGCAGG - Intergenic
1126328656 15:47508708-47508730 ACTAGGTGTGTACTCCCTGCGGG - Intronic
1126687033 15:51257371-51257393 CCTAGGTAGGCCCTCCAGGCTGG + Intronic
1126956251 15:53936305-53936327 ACTGGGTAGGGGCTCCCTGTGGG + Intergenic
1128856713 15:71024043-71024065 ACTAGGTAGGGCCTCCCTGCAGG + Intronic
1129567003 15:76633635-76633657 ACCAGGCAAGGCCTCCCTGTGGG - Intronic
1130030392 15:80308461-80308483 GCTAGACAGGGCCTCCCTGCGGG - Intergenic
1131453808 15:92567538-92567560 ACTCGGAATGGCCACCCTGCAGG + Intergenic
1131590897 15:93747138-93747160 ACTGGGTGGGGCCTCCCTGCAGG + Intergenic
1131600756 15:93846404-93846426 ACTGGGTAGGGCCTCCCTGTGGG + Intergenic
1131942738 15:97585169-97585191 ACTGTATGGGGCCTCCCTGCAGG - Intergenic
1132813947 16:1817146-1817168 AGTAGGCAGCGCCTCCCTGCGGG - Exonic
1132832952 16:1938374-1938396 CTTGGGAAGGGCCTCCCTGCAGG + Exonic
1135137567 16:19896223-19896245 TCTAGTGAGGGCCTCCTTGCTGG - Intergenic
1138270500 16:55692480-55692502 AGTTGGCAGGGCCTCCCTGGTGG - Intronic
1138882318 16:61031130-61031152 ACTGGGTGGGGCTTCCCTGCAGG - Intergenic
1141298797 16:82793997-82794019 ACCAAGAAGAGCCTCCCTGCTGG + Intronic
1141431003 16:83970126-83970148 ACTGGGCAGGGCTTCCATGCAGG - Intronic
1142125640 16:88409008-88409030 GCTAGGGAGGGCCCCCCTGCTGG - Intergenic
1142911591 17:3097956-3097978 ACTGGGTGGGGCCTCAATGCAGG + Intergenic
1143100227 17:4500480-4500502 CATAGGAAGGGGCTCCCTGCAGG + Intronic
1143625874 17:8109898-8109920 ACCAGGTGCGGCCTCCCTGCCGG - Exonic
1144120843 17:12150904-12150926 ACTGGGTGGGGCCTCCCTGCAGG + Intergenic
1144431789 17:15198987-15199009 ACCAGGAAGGGTCTCCCTTCAGG + Intergenic
1146817384 17:35953773-35953795 ACTAGGCAGGGCATCTCTGCAGG - Intergenic
1148628972 17:49092092-49092114 ACAAGGTATGGGCTCCCTGCTGG - Intergenic
1148875413 17:50684147-50684169 ACAAGGTGGGGCCTGCCTCCAGG - Intronic
1149174460 17:53853164-53853186 AGTGGGTGGGGCTTCCCTGCAGG + Intergenic
1149231892 17:54544510-54544532 AACAGGCAGGGCCTCCCTGCAGG + Intergenic
1149308706 17:55373571-55373593 ACAGGGTACGGCCTCCCTCCTGG - Intergenic
1149377928 17:56064444-56064466 ACTGGGCAGGGCTTCCCTGCAGG - Intergenic
1151950498 17:77350914-77350936 ACAAGGAAGGGCTTTCCTGCAGG + Intronic
1151994884 17:77602279-77602301 ACAACCTAGGGCCTCCCCGCAGG - Intergenic
1153858429 18:9174014-9174036 ACTGGGTGGGGCCTCCCTGAGGG - Intronic
1155464621 18:26120878-26120900 ACTGGGCAGGTCCTCCCAGCTGG + Intergenic
1156072080 18:33224174-33224196 TATATGTATGGCCTCCCTGCAGG + Intronic
1156230720 18:35151888-35151910 ACTGGGCAGGGCATCGCTGCAGG - Intergenic
1156244407 18:35284152-35284174 AGTAGGTAGCTCCTCTCTGCTGG + Intronic
1156529986 18:37805959-37805981 ACTGGGTGGGGCCTCACCGCAGG - Intergenic
1158676969 18:59529179-59529201 ACCGGGCAGGGCCTCCCTGTGGG - Intronic
1158765598 18:60447029-60447051 ACTGGGTGGGGCCTCCCTATGGG - Intergenic
1159076670 18:63688487-63688509 ACCAGGCAGGGCTTCCCTGCAGG + Intronic
1159186714 18:64984258-64984280 AGTGGGTAGCTCCTCCCTGCAGG - Intergenic
1159646181 18:70921111-70921133 ACCAGGCTGGGCCTCCCTGCAGG + Intergenic
1161735959 19:5992142-5992164 ACCAGGCAGGGCCCACCTGCGGG - Intergenic
1163850413 19:19659880-19659902 ATGAGGTAGGGACTGCCTGCTGG - Exonic
1163872173 19:19831113-19831135 ACTGGGCAGGGCCTCCCAGCAGG + Intergenic
1163886117 19:19966301-19966323 ACTGGGCAGGGCCTCCCAGCAGG - Intergenic
1163949652 19:20571873-20571895 ACTGGTCAGGGCCTCCCTGCAGG - Intronic
1163958415 19:20665041-20665063 ACTGGGCTGGGCCTCCCTGCAGG - Intronic
1163968425 19:20770030-20770052 ACTGGTCAGGGCCTCCCTGCAGG + Intronic
1164599762 19:29552895-29552917 ACCTGGTGGGGCCTCCCTGCAGG + Intronic
1166239646 19:41481154-41481176 ACTGGGAAGGTCCTCCCTGTTGG + Intergenic
1166239856 19:41482733-41482755 ACTGGGTAGGGCCTCCCTTTGGG + Intergenic
1166904924 19:46101434-46101456 ACTGGGCGAGGCCTCCCTGCAGG - Intergenic
925056634 2:861838-861860 ACCAGGTGGAGCCTCCCTGAGGG + Intergenic
926453872 2:13040402-13040424 ACTGGGTGGGACCTCCCTGCAGG + Intergenic
926987490 2:18640059-18640081 ACTGGGTAGGACCTCCCAGCTGG - Intergenic
927945354 2:27132186-27132208 GCTAGGTAGGGGGTCCCTGAGGG - Intronic
928757559 2:34545382-34545404 ACTGGGCGGGGCCTCCCTGAAGG - Intergenic
928850056 2:35734604-35734626 ACTGGGTAGGGCCTCCCTGAAGG + Intergenic
930318588 2:49827288-49827310 ACTGGGCAGGGCCTGCCTGCAGG - Intergenic
930545788 2:52765927-52765949 ACTGGGTGGGGCTTCCCTGCAGG + Intergenic
930581477 2:53217169-53217191 ACTGGGTGGGGCTTCCCTGTAGG - Intergenic
930951365 2:57147031-57147053 ACTGGGCAGGCCATCCCTGCAGG + Intergenic
932013484 2:68000883-68000905 ACTGGATAGGGCTTCCCTGCAGG + Intergenic
932434275 2:71694111-71694133 ACTAGGAAGGGACTGCGTGCGGG + Intergenic
933052078 2:77612376-77612398 ACTGGGCAGGGCCTCCCTGTGGG + Intergenic
933129506 2:78655241-78655263 ACTGGGCGGGGCTTCCCTGCAGG + Intergenic
933324270 2:80815589-80815611 ACTGGGCAGGGCATCTCTGCAGG + Intergenic
933436526 2:82257004-82257026 ACTAGATGGGGCCTTCCTGTGGG - Intergenic
934548689 2:95240931-95240953 ACTGGGTGGGACCTCCCTGCAGG + Intronic
934622853 2:95826154-95826176 ACTGGGTGGGGCATCCCTGCAGG - Intergenic
934810916 2:97275949-97275971 ACTGGGTGGGGCCTCCCTGCAGG + Intergenic
934826776 2:97431990-97432012 ACTGGGTGGGGCCTCCCTGCAGG - Intergenic
934923673 2:98366597-98366619 ACCAGGCAGGGCCTCCCCGCTGG - Intronic
935852288 2:107235771-107235793 ACTGGGCAGGGCATCTCTGCAGG + Intergenic
935952640 2:108345079-108345101 ACCAGGCAGGGCCTCCCTGTGGG - Intergenic
936849072 2:116873927-116873949 ACTGGGTGGGGCTTCCCTGAAGG - Intergenic
937679338 2:124627017-124627039 ACTGGAGAGGGCCTCCCTGTAGG + Intronic
937893946 2:126963328-126963350 AATGGGTGGGGCCTCCCTGCAGG - Intergenic
938136807 2:128765815-128765837 AGTGGGTGGGGCTTCCCTGCAGG - Intergenic
938408674 2:131046454-131046476 CCTGTGTAGGGCCTCACTGCTGG + Exonic
939022942 2:136980457-136980479 ATGGGGTGGGGCCTCCCTGCAGG - Intronic
939364961 2:141219380-141219402 ATTGGGCAGGGCCTCCCTGCAGG + Intronic
940167697 2:150793138-150793160 ACTGGGTGGGGCTTTCCTGCAGG + Intergenic
940592605 2:155748667-155748689 ACTGGGAGGAGCCTCCCTGCAGG + Intergenic
941088533 2:161147036-161147058 ATTGGGCGGGGCCTCCCTGCAGG - Intronic
941694358 2:168534942-168534964 ACTGGGTGGGGCTTCCCTGCAGG - Intronic
942856532 2:180555751-180555773 ACTGGGTGGGGTCTGCCTGCGGG + Intergenic
942989445 2:182181753-182181775 ACTGGGCAGGGCATCTCTGCAGG - Intronic
943349990 2:186785709-186785731 ACTGGGCAGGGCCTCCCTGTGGG + Intergenic
943420396 2:187661646-187661668 ACTGGGCAGGGCCTCCCAACCGG - Intergenic
944035515 2:195290449-195290471 ACCAAGCAGGGCCTCCCTGCAGG + Intergenic
944385131 2:199155240-199155262 ACTGGGCAGGGCTTCCCTGCAGG + Intergenic
944746396 2:202660968-202660990 ACTAGGTAGGAGGGCCCTGCAGG - Intronic
946136188 2:217649117-217649139 TCTAGTGAGGGCCTTCCTGCTGG - Intronic
946648734 2:221868568-221868590 ACTGTGCAGGGCCTCCCTGTGGG + Intergenic
947460128 2:230296850-230296872 ACTAGGTCCAGACTCCCTGCAGG + Intronic
947470395 2:230396186-230396208 ACTAGGTCCAGACTCCCTGCAGG + Intronic
947480078 2:230491378-230491400 ACTGGGTGGGGCTTCCCTGCAGG - Intronic
1168914812 20:1476981-1477003 ACTAGGAAGGGGCTCCATCCAGG + Intronic
1168933513 20:1644281-1644303 ACTGGGCAGGGCATCCCTCCAGG - Intronic
1169695750 20:8385239-8385261 ACTTGGTGGGGACTCCTTGCAGG - Intronic
1169980617 20:11379945-11379967 ATTGGGCAGGGCTTCCCTGCAGG + Intergenic
1170496618 20:16931067-16931089 ACTGGGCAGGGACTCCCTGCAGG + Intergenic
1171186836 20:23128903-23128925 ATTAGGTGAGGCCTCCCTGCAGG - Intergenic
1171282132 20:23909964-23909986 ACTGGGTAGGACCTCCCAACTGG - Intergenic
1173776694 20:45714464-45714486 ACTGGGTGGGGCCTCCCTGCTGG + Intergenic
1174559178 20:51417699-51417721 AATGGATGGGGCCTCCCTGCTGG - Intronic
1174673682 20:52332510-52332532 CCTAGGTTGGCCCTCCCTGCAGG - Intergenic
1174708659 20:52682767-52682789 AGTAGGCAGATCCTCCCTGCAGG + Intergenic
1174992138 20:55522743-55522765 ACTGGGCAGGGCCTCCCTGCAGG - Intergenic
1176237800 20:64062345-64062367 CCTAGGTAGGGCCAGACTGCAGG - Intronic
1176522958 21:7838511-7838533 ACTGGGTGGGGCCTCCCTGTGGG + Intergenic
1177388112 21:20433371-20433393 ACTAGGTGGGGCCTCCCTGCAGG + Intergenic
1177956573 21:27606110-27606132 ACTTGGTGGCGCCTCCCTGCAGG - Intergenic
1178656978 21:34468523-34468545 ACTGGGTGGGGCCTCCCTGTGGG + Intergenic
1180250354 21:46582154-46582176 AATGGGCAGGGCCTCCCTGTGGG - Intergenic
1181147440 22:20858846-20858868 ACTAGATAGGGCGTGGCTGCGGG + Intronic
1181377348 22:22470215-22470237 ACTTGGAAGTGCCTCCCTGGAGG + Intergenic
1184151732 22:42643539-42643561 CCCAGGCAGGGCCTCCATGCTGG + Intronic
1184785915 22:46671994-46672016 ACGTGGCAGGCCCTCCCTGCAGG - Intronic
949592751 3:5510745-5510767 ACTGGATGGGGCCTCCCTGCAGG + Intergenic
950587428 3:13904494-13904516 ACTGGGTGAGACCTCCCTGCAGG + Intergenic
950825979 3:15821839-15821861 ACTATGTAGTGGCTCCCTGAAGG + Intronic
951137260 3:19118360-19118382 ACTGGGTGGGGACTCCCTGCAGG + Intergenic
951432852 3:22628223-22628245 ACTGGACAGGGCCTCCCTGCAGG - Intergenic
951957763 3:28275826-28275848 ACTGGGCAGGGCCTCCCAGTGGG - Intronic
952634032 3:35505530-35505552 ACTGGGCGGGGCCTCCCTGCAGG + Intergenic
952744370 3:36763884-36763906 CCCAGGAAGGGCCCCCCTGCTGG + Intergenic
953115616 3:39989730-39989752 TCAAGGCAGGGCCTCCCTACAGG - Intronic
953816491 3:46162711-46162733 ACTGGGTAAGGCCTCCCAACTGG - Intergenic
954083468 3:48225837-48225859 ACTGGGTGCGGTCTCCCTGCAGG + Intergenic
954529240 3:51304126-51304148 AGTGGGTGGGGCCTCCCTGCAGG - Intronic
955832108 3:63015593-63015615 AGCGGGCAGGGCCTCCCTGCAGG - Intergenic
956157909 3:66317821-66317843 ACTGGGTAGTGCCTCCCTGTGGG - Intronic
957291359 3:78281711-78281733 AGTGGGTAGGGCTTCCCTGCAGG + Intergenic
957394756 3:79622616-79622638 ATTGGGTTGGGCTTCCCTGCAGG + Intronic
957434117 3:80151985-80152007 ACTGGGTAGGGCTTCCATACAGG - Intergenic
958483651 3:94676465-94676487 ACTGGGTGGGGCCTCCTTGTAGG + Intergenic
958522225 3:95204532-95204554 ACTGGGTGGGGCCTCCCTGCAGG - Intergenic
959031077 3:101300113-101300135 ACTGGGTGGGGCCTCCTTGCAGG - Intronic
959418352 3:106104264-106104286 ACTGGGCAGGGCCTCCCTGAAGG - Intergenic
959883522 3:111473598-111473620 ACCAGACAGGGCCTCCCTTCAGG - Intronic
960233465 3:115255063-115255085 ACTGGGCGGGGCTTCCCTGCAGG + Intergenic
961468508 3:127096636-127096658 ACTAGGCATGCCCTCTCTGCAGG + Intergenic
962691957 3:137907732-137907754 ACTGGGTGGGGCTTCCCTGCAGG + Intergenic
963400449 3:144791021-144791043 AGTGGGTAGGGCCTCCCTGAAGG - Intergenic
963756018 3:149235653-149235675 GCTGGGCAAGGCCTCCCTGCTGG + Intergenic
964007749 3:151851992-151852014 ACTGGGTGGGGCCTCTCTGCAGG - Intergenic
964295148 3:155225383-155225405 ACTGGGCAGGGCATCCCTGCAGG - Intergenic
965288794 3:166849683-166849705 ACCAGGCAAGGCCTCCCTGTGGG - Intergenic
965367844 3:167821298-167821320 ACTAGGTCTGGGCTCCCTGAAGG - Intronic
966539619 3:181075074-181075096 ACCGGGCAGGGCTTCCCTGCAGG - Intergenic
966652339 3:182315333-182315355 ACTGTGCAGGGCATCCCTGCAGG - Intergenic
968437209 4:599938-599960 ACTGCGTGGGTCCTCCCTGCAGG - Intergenic
968590394 4:1456101-1456123 GCTGGGTAGAGCCTCCCTCCTGG + Intergenic
970106921 4:12595502-12595524 ACCAGGGAGAGCCTCCCTGCAGG + Intergenic
970287963 4:14539431-14539453 ACTGGGTGGGGCTTCCCTGCAGG + Intergenic
970666486 4:18342918-18342940 ATTGGGTGGGGCTTCCCTGCAGG - Intergenic
971191780 4:24435413-24435435 AGTAGGAAGGGCTTCCATGCAGG - Intergenic
971286016 4:25290821-25290843 ACTAGGCGGGGCCTCCCTGCGGG - Intergenic
971574264 4:28253928-28253950 ACTGGGTGGGGCCTCCCTGTGGG + Intergenic
972861027 4:43169303-43169325 ACCATGCGGGGCCTCCCTGCAGG + Intergenic
972931000 4:44071632-44071654 AGTAGGTAGCTCCTCTCTGCAGG + Intergenic
973018694 4:45172687-45172709 ACTGGGCGGGGCCTCCCTGCAGG - Intergenic
973584687 4:52377987-52378009 ACTGGGTGGGGGTTCCCTGCAGG + Intergenic
974271486 4:59656367-59656389 ACTGGGCAGGGCTCCCCTGCAGG + Intergenic
974340048 4:60603551-60603573 ACTGGGCAGGGCCTCCCTGCAGG - Intergenic
974499711 4:62684270-62684292 ACTGGGTGGGGCCTCCCTACAGG + Intergenic
974741597 4:66014220-66014242 AATGGGTGGGGCTTCCCTGCAGG - Intergenic
974913239 4:68148578-68148600 ACTGGATGGGGCCTCCCTGCAGG - Intergenic
976375685 4:84342578-84342600 AATGGGTGGGGCCTCCCTACAGG + Intergenic
977086146 4:92601093-92601115 ACTGGATGGGGCCTCCCTGCAGG - Intronic
977508999 4:97938099-97938121 TCTGGGTGAGGCCTCCCTGCAGG - Intronic
977657247 4:99536433-99536455 ACTGGGTGGGGCCTTCCTGTGGG - Intronic
978327915 4:107579637-107579659 ACTGGGTGGGGCCTCCCTGTGGG + Intergenic
978940403 4:114429363-114429385 ACTGGGTGGGGCCTCCCTGCAGG - Intergenic
979576116 4:122294042-122294064 ACTGGGCAGGGCCTCCCTGCAGG + Intronic
979775449 4:124583493-124583515 ACTGGGTGGGGCTTCCCTGTAGG + Intergenic
980022106 4:127722657-127722679 ACTGGACAGGGCCTCCCTGTGGG - Exonic
980184665 4:129446506-129446528 ACTGGGTGAGGCCTCCCTGCAGG + Intergenic
980508904 4:133759703-133759725 ACTGGGTGAGGCCTCCCTGCAGG - Intergenic
980787405 4:137572802-137572824 AGTGGGTGGGGCCTCCCTGCAGG - Intergenic
980864855 4:138542625-138542647 ATTGGGCAGGGCCTCCCTGCAGG + Intergenic
981273843 4:142875018-142875040 ACCAGGTGGGGCTTCCCTGCAGG + Intergenic
981352838 4:143752463-143752485 TCTGGGCTGGGCCTCCCTGCAGG + Intergenic
982663158 4:158229707-158229729 ACTGGGCGGGGCCTCCCTGCAGG - Intronic
982859856 4:160434969-160434991 ACTGGGTGGGGCCTCCCTGTGGG - Intergenic
983485867 4:168331061-168331083 ACTAGGCAGGGCATCTCTGAAGG - Intergenic
983774900 4:171594752-171594774 ACCAGGCAGGGCCTCCCTGAAGG - Intergenic
983820933 4:172192949-172192971 AGCAGGTAGGGCTTCCCTGTGGG + Intronic
983892044 4:173039718-173039740 ACTATGTAGGGCCTACAAGCAGG - Intronic
984296684 4:177862303-177862325 ACTGGGTAGGTCCTTTCTGCAGG - Intronic
984853994 4:184177295-184177317 ACCAGATGGGGCCTCCCCGCAGG + Intronic
985516185 5:345916-345938 ACAAGGTAAGGTCTCCCTGCGGG - Intronic
985828800 5:2213020-2213042 AGCAGGGAGGGCGTCCCTGCAGG - Intergenic
986492444 5:8306749-8306771 ATTGGGCAGGGCTTCCCTGCAGG + Intergenic
986641975 5:9880902-9880924 ACTGGGTGGGGCCTCGCTGCAGG + Intergenic
986753579 5:10812449-10812471 ACTGGGTGGGGCCTCCCTGTGGG + Intergenic
987634803 5:20526196-20526218 ACCAGGCAGGGCCTCCCTGTAGG + Intronic
987674890 5:21062276-21062298 ACTGGGCAGGACCTCCCAGCTGG - Intergenic
987834683 5:23146151-23146173 AGTGGGTGGGGCATCCCTGCAGG - Intergenic
987988558 5:25181156-25181178 ACTGGGCAGGACCTCCCTGCAGG - Intergenic
988059519 5:26148986-26149008 AGTGGGTGGGGCATCCCTGCAGG + Intergenic
989140939 5:38200675-38200697 GCTATGTAGGGACTCCCTGAAGG + Intergenic
989276792 5:39598912-39598934 ACTGGGTGAGGCCTTCCTGCAGG - Intergenic
989676668 5:43981458-43981480 ACTGGGTGGGGCCTCTCTGCAGG - Intergenic
989682610 5:44046783-44046805 ACTAGGCAAGGCCTCCCTGTGGG - Intergenic
990230925 5:53712378-53712400 ACCAGGCAGGGCCTCCCTGTGGG - Intergenic
990620093 5:57550142-57550164 ACTGGGAGGGGCTTCCCTGCAGG - Intergenic
991227791 5:64292838-64292860 ACTGGGTGGGGCCTCACTGTGGG - Intronic
992571700 5:78065595-78065617 ACTGAGCTGGGCCTCCCTGCAGG + Intronic
993365519 5:87030144-87030166 ACTGGGTAGGGCCTCTCTGCAGG - Intergenic
993375921 5:87149469-87149491 ACGGGGCAGGGCCTCCCTGTGGG - Intergenic
993587316 5:89746931-89746953 ACTGGGCAGGGCCTCCCTGTAGG - Intergenic
993589606 5:89778169-89778191 ACTCGGCAGGGCCTCCCTGCAGG + Intergenic
994298815 5:98121810-98121832 ACTGGGCAGGGCCTCCCTGCAGG + Intergenic
994344148 5:98664826-98664848 ACCAGGTAGAGCCTCCCTGTGGG + Intergenic
994350698 5:98742729-98742751 ACTGGGCAGGTCCTCCCTTCAGG + Intergenic
995080682 5:108047724-108047746 ACTGGGTATGGCCTCCCTGCAGG + Intronic
995666201 5:114544943-114544965 ACTGGGTGGGGCTTCCCAGCAGG + Intergenic
996054615 5:118969095-118969117 ACTAGGTGGGGCTTCCCTGCAGG + Intronic
996463210 5:123770761-123770783 ACCTGGCAGGGCCTCCCTGTGGG - Intergenic
996675714 5:126172343-126172365 ATTGAGTGGGGCCTCCCTGCAGG + Intergenic
996893850 5:128456227-128456249 AGTGGGTGGGGCCTTCCTGCAGG + Intronic
997096953 5:130923982-130924004 ACTGGGTCGGGCCTCCCTGCAGG + Intergenic
998788842 5:145744106-145744128 ATTGGGTAGGGCTTCCCTGCAGG + Intronic
998976903 5:147658709-147658731 ACTAGGCAAGGTCTCTCTGCAGG - Intronic
999074314 5:148780382-148780404 ACTGGGTGGGACCTCCCAGCTGG + Intergenic
999938587 5:156515952-156515974 ACCAGGCAGGGCCTCCCTGTGGG + Intronic
1000509625 5:162165186-162165208 TCTGGGTGGGACCTCCCTGCTGG + Intergenic
1000509677 5:162165458-162165480 ACTGGGTAGGTCCTCCTAGCTGG + Intergenic
1001739116 5:174035297-174035319 ACTGGGCAGGGCCTCCCTGCAGG - Intergenic
1001839687 5:174864688-174864710 AGTGGGCAGGGCTTCCCTGCAGG - Intergenic
1003228002 6:4223734-4223756 GCAAGGTAGAGCCTCCCTCCTGG - Intergenic
1003248766 6:4406059-4406081 ACTGGGCAGGGCTTCCCTGCAGG + Intergenic
1003687084 6:8315052-8315074 ACTGGGCAGGGCTTCCCTGCAGG - Intergenic
1004760124 6:18656804-18656826 ACTGGGCGGGGCTTCCCTGCAGG + Intergenic
1004983951 6:21059123-21059145 ACTGAGTGGGGCCTCCCTGTGGG - Intronic
1005170631 6:22980732-22980754 ACTGGGTGGGGCCTCCCTGCAGG + Intergenic
1006241114 6:32679812-32679834 GCTTGGTGGGGCCTCTCTGCAGG - Intergenic
1006712168 6:36083635-36083657 ACGGGGCAGGGCCTCTCTGCGGG + Intronic
1007379271 6:41476641-41476663 CCTAGCTTGGGCCTCCGTGCAGG - Intergenic
1008834387 6:55808193-55808215 ACTGGGCAGGGCCTTCCTGCAGG - Intronic
1009230861 6:61059705-61059727 ATTGGGTGGGGCCTCCCTGTGGG - Intergenic
1009289825 6:61868523-61868545 ACTGGGCAGGACCTCCCAGCTGG - Intronic
1009316696 6:62229219-62229241 ACTGGGCAGGGCCTCCCTGAAGG - Intronic
1009707114 6:67266273-67266295 ACTAGGTGGGGCCTCCCGGCAGG - Intergenic
1011214165 6:84987382-84987404 ACTGGATGGGGCCTCCCTGTGGG + Intergenic
1011944198 6:92880697-92880719 ACTGGGTGGGGCTTCTCTGCAGG + Intergenic
1012063088 6:94511983-94512005 ACTGGGCGGGGGCTCCCTGCAGG + Intergenic
1012231804 6:96768702-96768724 ACCAGGAGGGTCCTCCCTGCAGG + Intergenic
1012616307 6:101283488-101283510 ACTAGGTGGGACCTCCCAACTGG + Intergenic
1012741154 6:103018244-103018266 ACTGGGTGGGTCCTCCTTGCAGG - Intergenic
1013920453 6:115396612-115396634 ACTGGGTGGGGCCTTCCTGTGGG - Intergenic
1013931985 6:115545410-115545432 ACTGGGCGAGGCCTCCCTGCAGG + Intergenic
1014369262 6:120584326-120584348 AGTGGGTGGGGCTTCCCTGCAGG - Intergenic
1014422318 6:121261067-121261089 ACTGGGTGGGGTCTCCCTACAGG + Intronic
1014770521 6:125453666-125453688 AGTGGGTAGCTCCTCCCTGCAGG - Intergenic
1014864035 6:126505985-126506007 ACTGGGCAGGGCCTCCCTGCAGG + Intergenic
1015358210 6:132305297-132305319 ACTGGGTGGGGCTTCCCTGGAGG + Intronic
1015368569 6:132425215-132425237 ACTGGGCAGGACCTCCCTGCAGG - Intergenic
1015505489 6:133982107-133982129 ATTAGGGAGGGCCTCTCTTCAGG + Intronic
1015587368 6:134789681-134789703 ACCAAGCAGGGTCTCCCTGCAGG + Intergenic
1015660160 6:135566287-135566309 ACTGGGTGGGGCCTCACTGCAGG - Intergenic
1017717373 6:157222297-157222319 TCAAGGAAGGGCCGCCCTGCGGG + Intergenic
1017912942 6:158810365-158810387 ACCAGGGAGGGCCTCCCGGCTGG - Intronic
1020598959 7:10248276-10248298 ACTGGGTAGGGCCTCCCTGCAGG + Intergenic
1020619118 7:10496942-10496964 ACCAGGCAGGGCCTCCCTGTGGG + Intergenic
1020621804 7:10528018-10528040 AGTGGGTGGGGCTTCCCTGCAGG + Intergenic
1021175899 7:17449515-17449537 ACTAGGCAGGATCTCCCAGCTGG - Intergenic
1021465449 7:20938078-20938100 AGTAGGTAGGGCCTCCTGGGAGG - Intergenic
1022634655 7:32120171-32120193 ACGGGGCAGGGCCTCCCTGAAGG + Intronic
1023207201 7:37763693-37763715 ACTGGGTGGGGCCTCCCTGCAGG + Intronic
1024290712 7:47801558-47801580 GCTAGGTAGGGCCTCTCTGTAGG - Intronic
1024566702 7:50687300-50687322 ACTTGGTAAGGCCTGACTGCTGG - Intronic
1024589985 7:50872779-50872801 GCTGGGCGGGGCCTCCCTGCAGG + Intergenic
1024795320 7:53012712-53012734 ACTGGGTCGTGCCTCCCTGAGGG - Intergenic
1024990536 7:55231788-55231810 ACTGGGCAGGGCCTCCCTGTGGG - Intronic
1025041704 7:55651425-55651447 ACTGAGTGGGGCCTCCCTGCAGG + Intergenic
1027452227 7:78345446-78345468 AACAGCCAGGGCCTCCCTGCTGG + Intronic
1028518000 7:91698999-91699021 ACTGGGTGGGGCCACCCTACAGG + Intronic
1028621661 7:92834401-92834423 ACCAGGGAGGTCCTCCCAGCCGG - Intronic
1028627024 7:92889065-92889087 ACTAGGCAGGGCCTCCCTGTGGG - Intergenic
1028644157 7:93076790-93076812 ACTGGGTTGGGACTCCCTGCAGG + Intergenic
1029041473 7:97580507-97580529 ACTCGGTAGGGCATCCCTGCAGG + Intergenic
1030413626 7:109213124-109213146 ACTGGGCAGGGCCTCCCTGCAGG - Intergenic
1030484459 7:110148794-110148816 AGTGGGTAGATCCTCCCTGCAGG + Intergenic
1030692174 7:112547147-112547169 ACCAAGCAGGGCCTCCCTGTGGG - Intergenic
1030696184 7:112588050-112588072 ACTGGGCAGGACCTCCCAGCTGG + Intergenic
1030701549 7:112646809-112646831 AGTGGGTGGGGCTTCCCTGCTGG - Intergenic
1030759373 7:113331878-113331900 ATTGGGTAGGGCCTCCCTGCAGG + Intergenic
1031804603 7:126292781-126292803 ATTGGGTGGGGCTTCCCTGCAGG + Intergenic
1031921924 7:127608713-127608735 AGTAGGTAGGTCCTTTCTGCCGG + Intergenic
1032504748 7:132426466-132426488 ACTAGGTGTGGCCTCCCTGTTGG + Intronic
1032919939 7:136534208-136534230 ACTGGGTGGGGCCTCCCTGCAGG + Intergenic
1033082248 7:138309305-138309327 TCTGGGGAGGGCCTTCCTGCTGG + Intergenic
1033868231 7:145718434-145718456 ACCAGGTGGGGCTTCCCTGCAGG - Intergenic
1033977223 7:147116777-147116799 ACTGGGTGGGACCTCCCAGCTGG - Intronic
1033989416 7:147265439-147265461 ACTGAGTGGGCCCTCCCTGCAGG + Intronic
1035382029 7:158446452-158446474 CCTGGGTGGGGCCTGCCTGCCGG - Intronic
1035491709 7:159284952-159284974 ACTGGGTGGGGCTTCCCTGCAGG + Intergenic
1035630838 8:1105533-1105555 ACAAGGTAGGAGCTTCCTGCCGG + Intergenic
1038286097 8:26207489-26207511 AGTAGATGGGGCGTCCCTGCTGG + Intergenic
1039265169 8:35816124-35816146 ACTGGGCAGGGCCTCCCTGCAGG + Intergenic
1039402249 8:37279660-37279682 ACTGGGTGGGGCTTCCCTGCAGG + Intergenic
1040059305 8:43090982-43091004 ACTAGTTAGGGACAGCCTGCAGG + Intergenic
1040614175 8:49018262-49018284 ACTAGGCAGGGCCTCCCTGCAGG - Intergenic
1040708870 8:50163124-50163146 ACCAGAAAGGGCCTCCCTGGAGG - Intronic
1040762980 8:50873789-50873811 ACTGGGTGGGGCCTCCCTACAGG - Intergenic
1040763112 8:50874439-50874461 ACTGGGTGGGGCCTCCCTACAGG + Intergenic
1040841835 8:51792764-51792786 ACTGGGCGGGGCCTCCCTGCTGG + Intronic
1040959787 8:53019344-53019366 ACTGGGTGGGGCTTCCCTGCAGG + Intergenic
1041474555 8:58249118-58249140 ACTGGGCGGGGCCTCCCTGTGGG + Intergenic
1041743096 8:61177266-61177288 ACTGGGCAGGGCCTCCCTGCAGG + Intronic
1042629971 8:70805684-70805706 ACTGGGTGAGGCTTCCCTGCAGG + Intergenic
1042683662 8:71414085-71414107 ACTATGTAGGGCCTTCCCTCTGG - Intronic
1042759682 8:72257259-72257281 ACTGGGCAGGGCCTCCCTGTGGG + Intergenic
1043233342 8:77830348-77830370 ACAGGGTGGGACCTCCCTGCAGG + Intergenic
1043363172 8:79499546-79499568 ACTGGGTGGGACCTCCCTGAAGG - Intergenic
1043929260 8:86071601-86071623 ACTATGAAGGCCCTCACTGCTGG - Intronic
1044117216 8:88350223-88350245 ACTGGGCCAGGCCTCCCTGCAGG - Intergenic
1044356133 8:91224898-91224920 AGTGGGTAGGGCTTCCCTGCAGG - Intronic
1044447575 8:92296852-92296874 ACTGGGCAGGACCTCCCTGTGGG - Intergenic
1046338880 8:112826049-112826071 ACTGGGTTGGGCCTCCCTGCAGG - Intronic
1046657697 8:116913082-116913104 ACCAGGCAGGGCCTCCCTGCTGG - Intergenic
1046986827 8:120397648-120397670 ACTGGGTGGTGCCTCCCTGCAGG + Intronic
1048038548 8:130701823-130701845 ACAAGGTAGGGCTAGCCTGCTGG + Intergenic
1048587692 8:135790555-135790577 ACTGGGTGGGGCCTCCCTGCAGG - Intergenic
1048856835 8:138693587-138693609 ACTGGGCGGGGCCTCCCTCCGGG + Intronic
1049438792 8:142599796-142599818 ACTAGCCAGGGACTCCCTGTTGG - Intergenic
1050618290 9:7426277-7426299 ACTGGGCGGGGCCTCCCTGCAGG - Intergenic
1050630117 9:7549669-7549691 ACTGGGTGGGGTTTCCCTGCAGG + Intergenic
1050982350 9:12036227-12036249 AGTAGGCAGGGCTTTCCTGCAGG + Intergenic
1051298090 9:15618202-15618224 ACTGGGCAGGGCATCTCTGCAGG - Intronic
1051459088 9:17293484-17293506 ACTGGGTGGGACCTTCCTGCAGG - Intronic
1051982935 9:23046143-23046165 ACTGGGCAGGGCATCTCTGCAGG + Intergenic
1052094677 9:24369747-24369769 ACTAGGTAGGGCCTCCCAGCTGG - Intergenic
1052515310 9:29472475-29472497 ACTTGGCAAGACCTCCCTGCAGG - Intergenic
1055343552 9:75310591-75310613 ACTGGACAGGGCCTCCCTGCAGG - Intergenic
1056002013 9:82227641-82227663 ACTTGGTGGGACCTCCCAGCAGG - Intergenic
1056127997 9:83555334-83555356 ACTGGGTAGGACCTCCCAACTGG - Intergenic
1056907574 9:90666544-90666566 ACTGGGCAGGACCTCCCAGCTGG - Intergenic
1057057243 9:91972819-91972841 ACTGGGCAGGACCTCCCTGTGGG + Intergenic
1057879374 9:98781685-98781707 ACGAGGAAGGGCATGCCTGCTGG + Intronic
1058530345 9:105900132-105900154 ACCAGGTGGGGCCTCCCTGTGGG - Intergenic
1058591039 9:106565559-106565581 ACTAGGCAGGGCCTCCCTGCAGG + Intergenic
1059004210 9:110383815-110383837 GCTAAGCAGGACCTCCCTGCGGG - Intronic
1059262690 9:112993763-112993785 ACTGGGTGGGGCCTCCCTGCAGG - Intergenic
1059596311 9:115724263-115724285 ACTGGGCAGGGCTTCCCTTCAGG + Intergenic
1060937905 9:127526671-127526693 ACCAGGTGGGGCTTCCCTGAGGG + Intronic
1187605219 X:20875046-20875068 ACTGGGCAGGGCCTCCCTGCAGG + Intergenic
1187646154 X:21349044-21349066 ACTGGGCAGGACCTCCCTGCAGG + Intergenic
1188099915 X:26071239-26071261 ACCAGGTGGGGCCTCTCTGCAGG - Intergenic
1188644928 X:32553956-32553978 ACTGGGTGGGACCTCCCTGAGGG + Intronic
1188669784 X:32868682-32868704 ACTGGGCAGGGCCTGCTTGCAGG + Intronic
1188744836 X:33829490-33829512 ACTGGGCGGGGCCTCCCTACAGG - Intergenic
1188884353 X:35531485-35531507 ACTGGGTGGGGCCTCCCTGCAGG + Intergenic
1189861412 X:45276183-45276205 ACTGGGTGGGACCTCCCTGCAGG - Intergenic
1190960410 X:55241104-55241126 ATTGGGCAGGGCCTCCCTGTGGG + Intronic
1191037668 X:56044516-56044538 ACTGGGTGGGACCTCCCTGCAGG - Intergenic
1191174132 X:57481935-57481957 AGTGGGTAGGGCATCCCTGAAGG - Intronic
1191185531 X:57607430-57607452 ACTGGGCAGGGCCACCCAGCAGG - Intergenic
1191225174 X:58035061-58035083 ACTGGGTGGGGCCTTCCTGCAGG - Intergenic
1191594122 X:62923398-62923420 ACTGGATGGGGCCTCCCTGTGGG + Intergenic
1191766700 X:64705765-64705787 ACCAGGCAGGGCATCCCTGCAGG - Intergenic
1191768823 X:64733037-64733059 AGCAGGCAGGGCCTCCCTGTGGG - Intergenic
1191815594 X:65241263-65241285 ACTGGGCAGGGCCTCCCTGTGGG - Intergenic
1191966709 X:66766810-66766832 ACTAGGCAGGGCATCTCTGAAGG - Intergenic
1192026361 X:67456867-67456889 ACTGGGTGGTGCCTCCCTGCAGG + Intergenic
1192292842 X:69815614-69815636 ACTAGGTGGGACCTCCCTGCGGG + Intronic
1192716461 X:73647645-73647667 ACTGGGTGGGGCCTCCCTGCAGG + Intronic
1192897608 X:75460215-75460237 ACTGGGCAGGACCTCCCTGTGGG + Intronic
1192930237 X:75799198-75799220 ACTGGGCAGGGCCTCCTGGCAGG - Intergenic
1192951948 X:76026546-76026568 ACTGAGTGGGGCTTCCCTGCAGG + Intergenic
1193091114 X:77494588-77494610 ACTAGGTGGGACTTCCCTGCAGG + Intergenic
1193176487 X:78400723-78400745 ACTGGGCAGGGCCTCTCTGTGGG + Intergenic
1193190334 X:78563415-78563437 ACTGGGCAGGGCCTCCCTGCAGG - Intergenic
1193365152 X:80623123-80623145 ACTTGGTTGGGCCTCCAGGCAGG - Intergenic
1193478415 X:81996299-81996321 ACCAGGCGGGGCCTCCCTGCAGG + Intergenic
1193595414 X:83439259-83439281 ACTGGATGGGGACTCCCTGCAGG - Intergenic
1193719499 X:84971378-84971400 AGTGGGCAGGGCTTCCCTGCAGG - Intergenic
1194177235 X:90665484-90665506 ACTGGGAGGGGCCTCCCTGCAGG + Intergenic
1194183115 X:90737683-90737705 ACTGGGCGGGGCCTCCCTGCAGG + Intergenic
1194193523 X:90865394-90865416 ACTGAGTGGGGCCTCCCTGAAGG + Intergenic
1194274403 X:91861405-91861427 ACTGGGCAAGGCCTCCCTACAGG - Intronic
1194286798 X:92020475-92020497 ATTGGGCAGGGCCTCCCTGCAGG + Intronic
1194405707 X:93493891-93493913 ACTGGATGGGGCCTCCCTGTGGG + Intergenic
1194445898 X:93986820-93986842 ACTGGGTGGGGCCTCTTTGCAGG + Intergenic
1194580621 X:95666265-95666287 ACTGGGTGTGGTCTCCCTGCAGG + Intergenic
1194635694 X:96342950-96342972 ACTAGGCAGGACCTCCCAACCGG - Intergenic
1194851978 X:98881235-98881257 ACTTGATGGGGCCTCCCTGCAGG + Intergenic
1195147189 X:102029452-102029474 ACTGGGTGGGGGCTCCCTGCAGG + Intergenic
1195979341 X:110561133-110561155 ACTGGGTGGGGCCTCCCTGCAGG - Intergenic
1196054492 X:111340305-111340327 ACTGGGTGGGGATTCCCTGCAGG + Intronic
1196555843 X:117083837-117083859 ACTGGGTAGGGACTCTCTGCAGG - Intergenic
1196558931 X:117123124-117123146 ACTAGGCAGGGCCTCCCTGCAGG + Intergenic
1196607342 X:117671708-117671730 AGTGGGCAGGGCTTCCCTGCAGG - Intergenic
1197023142 X:121715902-121715924 ACTGGGTGAGCCCTCCCTGCAGG - Intergenic
1197046465 X:122004054-122004076 AGTGGGCAGGGCTTCCCTGCAGG - Intergenic
1197049541 X:122042397-122042419 ACTGGGGAGTGCTTCCCTGCAGG - Intergenic
1197107367 X:122732163-122732185 ACTGGGCGGGGCTTCCCTGCAGG + Intergenic
1197319136 X:125006325-125006347 ATTAGGCAGGGCATCTCTGCAGG + Intergenic
1197403913 X:126027442-126027464 AGTGGGTGGGGCTTCCCTGCAGG - Intergenic
1197424032 X:126273058-126273080 ACCAGGCAGCGCCTCCCTGCGGG - Intergenic
1197428099 X:126323361-126323383 ACTGGGTGGGACCTCCCTGCAGG + Intergenic
1197522675 X:127519650-127519672 ACTGGGCAGGGCCTCCCTGCAGG + Intergenic
1197772609 X:130098833-130098855 TCTCTGTAGGGCCTGCCTGCAGG - Intronic
1197858793 X:130948108-130948130 ACTAGGGAGCTCCTCCCTGAAGG - Intergenic
1198699414 X:139381797-139381819 AATAGGTAGCTCCTCACTGCAGG + Intergenic
1198786345 X:140292404-140292426 ACTGGGCAGGGCTTCCCTGAGGG - Intergenic
1198841365 X:140861134-140861156 ACTGGGCAAGGCCTCTCTGCAGG + Intergenic
1199035812 X:143050237-143050259 ACTGGACAGGGCCTCCCTGTGGG - Intergenic
1199039783 X:143098927-143098949 ACTAGGGAGGGCCTCACTTATGG - Intergenic
1199173360 X:144757344-144757366 ACCGGGTGGGGCCTCCCTGCAGG - Intergenic
1200529729 Y:4319638-4319660 ACTGGGCGGGGACTCCCTGCAGG + Intergenic
1200540134 Y:4447781-4447803 ACTGAGTGGGGCCTCCCTGAAGG + Intergenic
1200591637 Y:5082811-5082833 ACTGGGCAAGGCCTCCCTACAGG - Intronic
1200604345 Y:5245035-5245057 ATTGGGCAGGGCCTCCCTGCAGG + Intronic
1201979666 Y:19893016-19893038 ATTGGGTAGGGCCTCCCTGCAGG + Intergenic