ID: 1128856713

View in Genome Browser
Species Human (GRCh38)
Location 15:71024043-71024065
Sequence ACTAGGTAGGGCCTCCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 553
Summary {0: 1, 1: 7, 2: 61, 3: 170, 4: 314}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128856707_1128856713 -10 Left 1128856707 15:71024030-71024052 CCCATCCCTGCTTACTAGGTAGG 0: 1
1: 0
2: 1
3: 12
4: 176
Right 1128856713 15:71024043-71024065 ACTAGGTAGGGCCTCCCTGCAGG 0: 1
1: 7
2: 61
3: 170
4: 314
1128856703_1128856713 25 Left 1128856703 15:71023995-71024017 CCCAGAGACAGGAATGGCAGCCA 0: 1
1: 0
2: 1
3: 24
4: 266
Right 1128856713 15:71024043-71024065 ACTAGGTAGGGCCTCCCTGCAGG 0: 1
1: 7
2: 61
3: 170
4: 314
1128856704_1128856713 24 Left 1128856704 15:71023996-71024018 CCAGAGACAGGAATGGCAGCCAT 0: 1
1: 0
2: 2
3: 29
4: 212
Right 1128856713 15:71024043-71024065 ACTAGGTAGGGCCTCCCTGCAGG 0: 1
1: 7
2: 61
3: 170
4: 314
1128856705_1128856713 5 Left 1128856705 15:71024015-71024037 CCATCACTGCAGTAACCCATCCC 0: 1
1: 0
2: 1
3: 13
4: 159
Right 1128856713 15:71024043-71024065 ACTAGGTAGGGCCTCCCTGCAGG 0: 1
1: 7
2: 61
3: 170
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128856713 Original CRISPR ACTAGGTAGGGCCTCCCTGC AGG Intronic