ID: 1128857540

View in Genome Browser
Species Human (GRCh38)
Location 15:71031971-71031993
Sequence CTGGCTTCAGACCGCTTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1715
Summary {0: 1, 1: 10, 2: 663, 3: 617, 4: 424}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128857536_1128857540 2 Left 1128857536 15:71031946-71031968 CCACTGAGTGAGACCACTTGGCT 0: 31
1: 63
2: 392
3: 407
4: 393
Right 1128857540 15:71031971-71031993 CTGGCTTCAGACCGCTTTCCAGG 0: 1
1: 10
2: 663
3: 617
4: 424
1128857535_1128857540 3 Left 1128857535 15:71031945-71031967 CCCACTGAGTGAGACCACTTGGC 0: 15
1: 60
2: 135
3: 180
4: 267
Right 1128857540 15:71031971-71031993 CTGGCTTCAGACCGCTTTCCAGG 0: 1
1: 10
2: 663
3: 617
4: 424

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128857540 Original CRISPR CTGGCTTCAGACCGCTTTCC AGG Intronic
900039017 1:441403-441425 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
900060449 1:676379-676401 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
900563082 1:3317661-3317683 CTGCCCTCAGACGGCTTCCCAGG - Intronic
900989301 1:6090659-6090681 CTGGCTGCAGACCCCTCGCCAGG + Intronic
903566934 1:24274728-24274750 CTGGCTTTAGTCCCCTTTCCAGG + Intergenic
904920955 1:34007538-34007560 GTGGCTTCAAATTGCTTTCCAGG - Intronic
906557836 1:46728509-46728531 CTGGCTTCAGTCTCCCTTCCAGG - Intergenic
906579574 1:46925388-46925410 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
906586733 1:46984870-46984892 CTGGCTTTAGCCCCCTTTCCAGG - Intergenic
906604148 1:47153498-47153520 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
906739965 1:48173198-48173220 CTGGCATCAGCCCCATTTCCAGG + Intergenic
906753253 1:48285406-48285428 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
906766123 1:48436021-48436043 CTGGTTTCAGACTGTTTTTCAGG - Intronic
906843118 1:49161028-49161050 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
907015163 1:51005385-51005407 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
907600103 1:55760542-55760564 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
907953526 1:59206647-59206669 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
908598294 1:65711520-65711542 CTGGCTTCAGGCCCCTTTCCGGG + Intergenic
908611419 1:65865356-65865378 CTGTCTTCAGCCCCCTTTCCAGG + Intronic
908724100 1:67156788-67156810 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
909211498 1:72830608-72830630 CTGGCTTCAGCCTCCTTTCCAGG - Intergenic
909403278 1:75258203-75258225 CTGGCTTCAGCCCCCTTTCTAGG - Intronic
909415656 1:75402858-75402880 CTGGCTTCAGCACCCTTTCCAGG - Intronic
909493147 1:76247799-76247821 CTGGCTTCATCCCCCTTTCCAGG + Intronic
909536436 1:76741615-76741637 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
909690155 1:78398204-78398226 CTGGCTTCAGCCCCCTTTCCGGG + Intronic
910177190 1:84443232-84443254 CTGGCCTCAGCCCCCTTTCCAGG - Intergenic
910330982 1:86072172-86072194 CTGGCTTCAGCCTCCTTTCCAGG - Intronic
910604830 1:89072037-89072059 CTGGCTTCAGCCTCCTTTCCAGG - Intergenic
910799512 1:91131414-91131436 CTGGCTTCAGCCGCCTTTCCAGG - Intergenic
910805749 1:91188616-91188638 CTGGCTTCAGCCCCCTTTCTAGG + Intergenic
910827862 1:91428447-91428469 CTGGCTTCAGCCTCCTTTCCAGG + Intergenic
911270638 1:95797376-95797398 CTGGCTTCAGCCCTGTTTCCAGG - Intergenic
911284639 1:95974908-95974930 CTGGCTTCAGCCCTCTTTCCAGG + Intergenic
911530682 1:99039703-99039725 CTGGCTTCTGCCCGCTTTCCAGG - Intergenic
911632635 1:100200069-100200091 TTGGCTTCAGCCTCCTTTCCAGG - Intronic
911692067 1:100845618-100845640 CTGGCTTTAGCCCTCTTTCCAGG + Intergenic
911982737 1:104586538-104586560 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
912032396 1:105265307-105265329 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
912076747 1:105884666-105884688 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
912150500 1:106853413-106853435 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
912235318 1:107844483-107844505 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
912242762 1:107927984-107928006 CTGGCTTCAGAGCACAGTCCCGG + Intronic
912271053 1:108209420-108209442 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
912301416 1:108520717-108520739 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
912675781 1:111679574-111679596 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
912680624 1:111726828-111726850 CTGGCTTCTCCCCGCTTTCTGGG + Exonic
912894896 1:113576168-113576190 CTGGCTTCAGCCCCCTTTGCAGG + Intronic
912966226 1:114239740-114239762 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
913021470 1:114792314-114792336 CTGGTTTCCGCCCTCTTTCCAGG + Intergenic
913036316 1:114969622-114969644 CAGGCTTCAGCCCCTTTTCCAGG + Intronic
913108678 1:115639450-115639472 CTGGCTTCAGCCCCCATTCCAGG + Intergenic
913430124 1:118781256-118781278 CTGGCTTCAGCCATTTTTCCAGG + Intergenic
914442025 1:147716224-147716246 CTGGATTGGGACCCCTTTCCAGG - Intergenic
914967145 1:152270127-152270149 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
914969222 1:152291990-152292012 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
915061382 1:153188651-153188673 CTGGCTTCAACACCCTTTCCAGG + Intergenic
915634810 1:157178578-157178600 CTGTCTTCATCCCTCTTTCCAGG - Intergenic
915639254 1:157209615-157209637 CTGGCTTCAGACTTCTTCTCTGG + Intergenic
915649061 1:157294388-157294410 CTGGCTTCAGCCCCCTTTTCAGG - Intergenic
915658897 1:157384562-157384584 CTGGCTTCAGATTTCTTCCCTGG + Intergenic
915663602 1:157424425-157424447 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
915876504 1:159616537-159616559 CTGGCTTCAGCTCCCTTTCCAGG - Intergenic
916140528 1:161693310-161693332 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
916359530 1:163952716-163952738 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
916362855 1:163990445-163990467 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
916406256 1:164500641-164500663 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
916545659 1:165801603-165801625 TAGGCTTCAGCCCCCTTTCCAGG - Intronic
916612817 1:166409879-166409901 CTGGCTTCAGCCTCCTTTCCAGG + Intergenic
916625615 1:166552397-166552419 CTGGCTTCAGCCCTTTTTCCAGG + Intergenic
916878742 1:168998549-168998571 CTGGCTTCAGCCCGCTTTCCAGG + Intergenic
916916082 1:169408081-169408103 CTGGCTTTAGCCCCCTTTCCAGG - Intronic
916938526 1:169656427-169656449 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
916973430 1:170048988-170049010 TTGGCTTCCGCCCCCTTTCCAGG - Intronic
917007032 1:170426621-170426643 CTTGCTTCAGCCCCTTTTCCAGG - Intergenic
917009790 1:170458039-170458061 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
917019358 1:170569337-170569359 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
917023391 1:170614507-170614529 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
917091714 1:171359698-171359720 CTGGCTTCAGCCTCCTTTCCAGG - Intergenic
917157929 1:172024964-172024986 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
917163164 1:172080602-172080624 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
917232824 1:172856245-172856267 CTGGCTTCAGCCCCATTTCCAGG + Intergenic
917274615 1:173319006-173319028 CTGGCTTCAGCTGCCTTTCCAGG - Intergenic
917357742 1:174144033-174144055 CCGGCTTCAGCCCCCTTTCCAGG - Intergenic
917401396 1:174653275-174653297 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
917405955 1:174708835-174708857 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
917585000 1:176417147-176417169 CTGGCTTCAGCTCTCTTTCCAGG + Intergenic
917915195 1:179694512-179694534 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
918163342 1:181920897-181920919 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
918167261 1:181961903-181961925 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
918195639 1:182218940-182218962 CTGGCTTCAGACCCCTTTCCAGG - Intergenic
918353694 1:183684566-183684588 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
918612856 1:186512392-186512414 TTGGCTTCAGCCCCCTTTCCAGG + Intergenic
918632107 1:186730578-186730600 CTGGCTTCAGCCCCGTTTCCAGG + Intergenic
918684380 1:187396977-187396999 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
919146796 1:193645376-193645398 CTGGCTTCAGCCCCTTTTCCAGG + Intergenic
919214469 1:194534616-194534638 CTGGCTTTACCCCACTTTCCTGG - Intergenic
919461687 1:197884496-197884518 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
919598971 1:199599629-199599651 CTGGCTTCAGCCCCCTTTCTGGG - Intergenic
919601876 1:199633008-199633030 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
920401997 1:205681735-205681757 CTGACTCCTGACCTCTTTCCTGG - Intergenic
920985571 1:210885556-210885578 CTGGCTTCAGCCCCCTTCCCAGG - Intronic
921296873 1:213712492-213712514 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
921401405 1:214727625-214727647 CTGGCTTCAGCCCCCCTTCCAGG + Intergenic
921484878 1:215703790-215703812 CTGGCTTCAGCCCCCTTTTCAGG + Intronic
921626163 1:217379829-217379851 CTGGCTTCAGCTCCCTTTCCAGG - Intergenic
921738256 1:218653439-218653461 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
921962218 1:221047598-221047620 CTGGCTTCAGCCCCCTTTTCAGG - Intergenic
921976312 1:221207062-221207084 CTGGCTTCAGCACCCTTTTCAGG - Intergenic
922066191 1:222145936-222145958 ATGGCTTCTGCCCCCTTTCCAGG - Intergenic
922396778 1:225210173-225210195 CTGGTTTCAGCCTCCTTTCCAGG - Intronic
922406238 1:225316329-225316351 CTGGCTTCAGCTCCCTTTCCAGG + Intronic
922666517 1:227474054-227474076 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
922715994 1:227872350-227872372 CTGGCTTCAGCCTCCTTTCCAGG - Intergenic
922862409 1:228830534-228830556 CTGGGCTCTGACTGCTTTCCAGG + Intergenic
923066989 1:230527248-230527270 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
923421710 1:233822450-233822472 CTGGTTTCAGCCCCCTTTCCGGG - Intergenic
923690931 1:236192302-236192324 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
923853408 1:237820686-237820708 CTGGTTTCAGCCCCCTTTCCAGG - Intronic
924253416 1:242158287-242158309 CTGGCTTCAGCCTCCTTTCCAGG + Intronic
924254563 1:242169592-242169614 CTGGCTTCAGCCTCCTTTGCAGG - Intronic
924295999 1:242587111-242587133 CTGGCTTCAGCCGCCTTTCCAGG - Intergenic
924823128 1:247513485-247513507 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
924829031 1:247573148-247573170 CTGGCTTCAGCCCCTTTTCCAGG + Intronic
924878201 1:248128753-248128775 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
924883652 1:248189093-248189115 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
924894070 1:248316958-248316980 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1063211580 10:3885854-3885876 CTGGCTTCAGACCCCTTGGGCGG + Intergenic
1063337977 10:5234956-5234978 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1063453673 10:6168361-6168383 GTGGCTTCAGTCAGCCTTCCTGG + Intronic
1064757835 10:18587938-18587960 CTGGCATTAGCCCCCTTTCCAGG - Intronic
1065120997 10:22530349-22530371 CTGACTTCAGACTGCTGTGCTGG + Intergenic
1065121011 10:22530453-22530475 CTGTCTTCAGCCCCCTTTCCAGG + Intergenic
1065196431 10:23270542-23270564 CTGGATTCAGTCCCCTTCCCCGG - Intronic
1065427400 10:25619673-25619695 CTGGCTTCAGCCTCCTTTCCAGG - Intergenic
1065484397 10:26222863-26222885 CAGGCTTCAGACAGATGTCCAGG + Intronic
1065621589 10:27587482-27587504 CTGGCTTCAGCCCTCTTTCCAGG - Intergenic
1065651720 10:27899477-27899499 CTGGCTTCAGCCTCCTTTCCAGG - Intronic
1065907636 10:30272271-30272293 CTGGCTTCAGCACCTTTTCCAGG - Intergenic
1066159641 10:32714563-32714585 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1066257659 10:33696262-33696284 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1066993514 10:42539682-42539704 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1067162186 10:43836534-43836556 CTGGCTTCAGTCCTCTTTCCAGG + Intergenic
1067209711 10:44249887-44249909 GTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1067236396 10:44454168-44454190 TTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1067251997 10:44594285-44594307 CTGGATTCAGCCCCCTTTCCAGG - Intergenic
1067329470 10:45301525-45301547 CTGGCTTCAGTTCCCTTTCCAGG + Intergenic
1067332290 10:45333602-45333624 CTGGCTTCGGCCCCCTTTCCAGG + Intergenic
1068086119 10:52375205-52375227 CTGGCTTCAGCCCCCATTCCAGG + Intergenic
1068357130 10:55923488-55923510 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1068369641 10:56096008-56096030 CTGGCTTCAGCCCCCTTTGCAGG + Intergenic
1068469975 10:57448456-57448478 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1068575142 10:58676287-58676309 CTGGCTTCAGCCCCCCTTCCAGG - Intronic
1068951550 10:62782470-62782492 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1069120842 10:64567443-64567465 CTGGCTTCATCCCCCTTTCCAGG + Intergenic
1069139938 10:64810412-64810434 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1069329743 10:67278098-67278120 CTGGATTGGGACCCCTTTCCAGG + Intronic
1069348997 10:67502945-67502967 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1069684944 10:70312016-70312038 ATGGCTCCAGAATGCTTTCCTGG + Intronic
1070213150 10:74347581-74347603 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1070234483 10:74609215-74609237 CTGGCTTTATCCCCCTTTCCAGG + Intronic
1070349239 10:75576031-75576053 CTGGCTTCAGCCCACTTTTCAGG - Intronic
1070632454 10:78096533-78096555 CTGGCTTCAGCCCCCTTTCCGGG - Intergenic
1070802500 10:79251823-79251845 ATGGCTTCTGTCCGTTTTCCAGG - Intronic
1070999711 10:80818034-80818056 CTGGCTTCAGCCTGCTTTCCAGG - Intergenic
1071002039 10:80841727-80841749 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1071272399 10:84020078-84020100 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1071375435 10:84997495-84997517 CTTTCTTCAGAGCTCTTTCCTGG + Intergenic
1071975874 10:90955278-90955300 CTGGCTTCAGACCCCTTTCCAGG + Intergenic
1072044861 10:91644308-91644330 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1072358981 10:94640323-94640345 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1072365378 10:94703712-94703734 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1072375710 10:94813763-94813785 CTGGCTTCAGTCCTCTTTCCAGG + Intronic
1072389586 10:94969415-94969437 CTGGCTTCAGTCCTCTTTCCAGG + Intronic
1072394711 10:95026758-95026780 CTGGCTTCAGCCGCCTTTTCAGG + Intergenic
1072404386 10:95136345-95136367 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1072493721 10:95934357-95934379 CTGGCTTCAGCCTCCTTTCCAGG + Intronic
1072876160 10:99175284-99175306 CTGGTTTCAGCCCCCTTTCTGGG - Intronic
1073571252 10:104582807-104582829 CTGGCTACAAACCACTCTCCAGG + Intergenic
1074021967 10:109593697-109593719 CTGGATTCAGCCCTCTTTCTAGG - Intergenic
1074648534 10:115491724-115491746 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1074795530 10:116939143-116939165 CTGGCTTCTGCCCCCTTTCCAGG + Intronic
1074985192 10:118652253-118652275 CTGGCTTTAGCCCCATTTCCAGG + Intergenic
1075652519 10:124138311-124138333 CTGGCTTCAGGACAATTTCCTGG - Intergenic
1075983936 10:126767023-126767045 CTGGCTTCAGCCCCCTTTTCAGG + Intergenic
1076389778 10:130090576-130090598 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1076965226 11:77312-77334 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1077349496 11:2085894-2085916 CTGGCTTCAAAACGCCCTCCAGG - Intergenic
1077428328 11:2498662-2498684 CTGGCCTCAGCCCCCTTTCCAGG + Intronic
1077562070 11:3270398-3270420 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1077567964 11:3316218-3316240 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1077713633 11:4559566-4559588 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1078331501 11:10426066-10426088 TAGGCTTCAGCCCCCTTTCCAGG + Intronic
1078336285 11:10465891-10465913 CTGGCTTTAGCCCCCTTTCCAGG - Intronic
1078392922 11:10952241-10952263 CTGGCTTCAGCCCCGTTTTCAGG + Intergenic
1078429167 11:11274355-11274377 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1078743446 11:14090124-14090146 CTGGTTTCAGCCCCCTTTCCAGG + Intronic
1078809448 11:14743538-14743560 CTGGCTTCAACTCCCTTTCCAGG + Intronic
1078814139 11:14802109-14802131 CTGGCTTTAGCCCTCTTTCCGGG + Intronic
1079120817 11:17683627-17683649 ATGGCTTCAGACCTGTTTCCTGG - Intergenic
1079262553 11:18897513-18897535 CTGGCTTCAGCCCCCTTCTCAGG + Intergenic
1079264849 11:18921244-18921266 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1079267024 11:18943391-18943413 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1079316507 11:19412086-19412108 CTGGCTTCAGCTCCCTTTCCAGG - Intronic
1079349033 11:19677233-19677255 CTGGCTGCAGAGTGATTTCCAGG + Intronic
1079696102 11:23484184-23484206 CTGGTTTCAGTCCCCTTTCCAGG - Intergenic
1079714884 11:23732060-23732082 CTGGCTTCCACCCCCTTTCCAGG - Intergenic
1079799800 11:24854596-24854618 CTGGCTTCAGCACCCTTTCCAGG + Intronic
1080121275 11:28680663-28680685 GTGGCTTCAGACCGATTTGCAGG + Intergenic
1080334520 11:31180877-31180899 CTGGCTTCAGTTCCCTTTCCAGG - Intronic
1080710038 11:34737996-34738018 CTGGCTTCAGCCCCCTTGACAGG - Intergenic
1080965646 11:37211091-37211113 CTGGCTTCAGCTCGCTTTCCAGG + Intergenic
1081080223 11:38732068-38732090 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1081094979 11:38921294-38921316 CTGGCTTCAGCCCATTTTCCAGG + Intergenic
1081118264 11:39232242-39232264 CTGGCTTCAGCCCCTTTTCCAGG - Intergenic
1081198776 11:40192615-40192637 CTGGCTTCAGCCCACTTTCCAGG - Intronic
1081221571 11:40469544-40469566 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1081252364 11:40851105-40851127 CTGACTTCAGCTCCCTTTCCAGG + Intronic
1081317750 11:41651061-41651083 CTGGCTTCACCCCCCTTTGCAGG + Intergenic
1081363276 11:42205516-42205538 CTGGCTTCAGCCCCTTTTTCAGG - Intergenic
1082670685 11:56033288-56033310 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1082872160 11:57953511-57953533 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1082876345 11:57992671-57992693 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1082903621 11:58283264-58283286 CTGGCTTCAGTCGCCTTTCCAGG + Intergenic
1082924361 11:58530211-58530233 CTGGCTTAAGCCCCCTTTCCAGG - Intronic
1083385545 11:62306632-62306654 CTGGCTTCAGCCCCTTTCCCAGG + Intergenic
1083516241 11:63261795-63261817 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1083535059 11:63459827-63459849 CTGGCTTCAGCCTCCTTTCCAGG + Intergenic
1083682725 11:64358848-64358870 CTGGCTGCAGCCGGCATTCCCGG + Intergenic
1084238804 11:67805338-67805360 CTGGCTTCCGCCCGGTCTCCGGG - Intergenic
1085082846 11:73648245-73648267 CTGGCTTCAAACCGTTATGCCGG - Intronic
1085305234 11:75482049-75482071 CTGCCTTCACACTCCTTTCCCGG + Intronic
1085433837 11:76481408-76481430 CTGGCTTCAGCTCCCTTTCCAGG - Intronic
1085683814 11:78603411-78603433 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1085850050 11:80109511-80109533 CTGGTTTCAGCCCCTTTTCCAGG - Intergenic
1085884430 11:80505738-80505760 CTGGCTTCAGCCTCCTTTCCAGG - Intergenic
1085908879 11:80797955-80797977 TTGGCTTCAGCCCACTTTCCAGG - Intergenic
1086086056 11:82956360-82956382 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1086129181 11:83383156-83383178 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1086129195 11:83383236-83383258 TTGGCTTCAGACTGCTGTGCTGG - Intergenic
1086348853 11:85924773-85924795 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1086410694 11:86541309-86541331 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1086421892 11:86645225-86645247 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1086505274 11:87497843-87497865 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1086532385 11:87801162-87801184 CTGGCTTCAGCCCACTTTCCAGG + Intergenic
1086608429 11:88725060-88725082 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1086732846 11:90271040-90271062 CTGGCTTCAGTCCCCCTTCCAGG + Intergenic
1086735679 11:90302616-90302638 CAGGCTTCATCCCCCTTTCCAGG + Intergenic
1086907338 11:92433211-92433233 CTGGCTTCAGCTGCCTTTCCAGG + Intronic
1087427753 11:98012549-98012571 CTGGCTTCAGCCTTCTTTCCAGG - Intergenic
1087596105 11:100256964-100256986 CTGGCTTCAGCCCCCTTTCTAGG - Intronic
1087667771 11:101070487-101070509 CTGGCTTCAGCCCCCCTTCCAGG - Intronic
1087695317 11:101369784-101369806 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1087703811 11:101466683-101466705 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1087712174 11:101567035-101567057 CAGACTTCAGCCCCCTTTCCAGG - Intronic
1087830996 11:102819866-102819888 CTGGCTTCAGCCCCCTTTTCAGG + Intergenic
1088034633 11:105296632-105296654 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1088211951 11:107466432-107466454 CTGCCTTTAGTCCCCTTTCCAGG + Intergenic
1088294495 11:108277343-108277365 CTGGCTTCAGCCCCCTTTCTAGG + Intronic
1088307245 11:108423245-108423267 CTGGCTTCAGCCCCCTTTCTAGG - Intronic
1088702527 11:112426220-112426242 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1089013906 11:115151493-115151515 CTGGCTTCAGCCCCCCATCCTGG + Intergenic
1089200327 11:116720789-116720811 CTAGCTACAGATCCCTTTCCTGG - Intergenic
1089684426 11:120137845-120137867 CTGGCTTCAGGGCGCTGCCCAGG + Exonic
1089766052 11:120766430-120766452 CTGGCATCAGCCCCCTTTTCAGG + Intronic
1090307468 11:125703604-125703626 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1090312676 11:125756077-125756099 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1090318396 11:125818105-125818127 CTGGCTTCAACCCTCTTTCCAGG - Intergenic
1090688849 11:129156254-129156276 CTGGCTTTAGCCCCCTTTCCAGG - Intronic
1090720390 11:129467211-129467233 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1090811669 11:130249929-130249951 CTGGCTTCAGCCCCCTTTGCAGG - Intronic
1090896132 11:130977066-130977088 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1091090051 11:132762791-132762813 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1091213543 11:133885218-133885240 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1091712135 12:2749600-2749622 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1091712252 12:2750315-2750337 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1091958732 12:4672396-4672418 CTGGCTTCAGCCCACTTTCCAGG - Intronic
1092304347 12:7283716-7283738 CTGGCCTCAGCCCCCTTTCCAGG - Intergenic
1092320712 12:7471757-7471779 CTTGCTTCAGCCCCCTTTCCAGG - Intronic
1092581705 12:9849568-9849590 CTTGCTTCAGTCCCCTTTCCAGG + Intergenic
1092628971 12:10358502-10358524 CTGGCTTTAGCCCCCTTTCCAGG + Intergenic
1092637427 12:10466879-10466901 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1092638869 12:10481835-10481857 CTGGCTTCAGCCGCCTTTCCAGG - Intergenic
1092690886 12:11108831-11108853 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1092703232 12:11256508-11256530 CTGGCTTCAACTCCCTTTCCAGG - Intergenic
1093004400 12:14035939-14035961 CTGGCTTCAGCCTCCTTTCCAGG - Intergenic
1093333191 12:17868565-17868587 CTGGCTTCAGCCCCCTTTTGAGG - Intergenic
1093336065 12:17906030-17906052 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1093376769 12:18438235-18438257 GTGTCTACAGACCCCTTTCCAGG + Intronic
1093402284 12:18761116-18761138 CTGGCTTCAGCTCCCTTTCCAGG - Intergenic
1093545069 12:20336588-20336610 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1093610507 12:21149864-21149886 CTAGCTTCAGCCCCTTTTCCAGG - Intronic
1093664487 12:21795527-21795549 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1093694734 12:22146645-22146667 CTGGCTTTAGTCCCCTTTCCAGG - Intronic
1093714478 12:22366100-22366122 CTGGCTTCAGCTCCCTTTCCAGG - Intronic
1093835623 12:23825068-23825090 CTAGCTTCAGCCCCCTTTCCAGG + Intronic
1094061086 12:26316180-26316202 CTGACTTCAGACTGCTGTGCTGG + Intergenic
1094061102 12:26316284-26316306 CTGGCTTCAGCCCTCTTTCCAGG + Intergenic
1094733131 12:33200845-33200867 CTGGCTTCATCCCCCTTTCCAGG + Intergenic
1094755380 12:33462879-33462901 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1094757836 12:33492732-33492754 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1094782081 12:33802809-33802831 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1095119954 12:38405339-38405361 CTGACTTCAGCCCCCTTTCCAGG + Intergenic
1095230515 12:39733880-39733902 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1095356403 12:41280377-41280399 CTGGCTTCAGCTCCCTTTCCAGG - Intronic
1095406319 12:41870693-41870715 CTGGCTTCAGCCCCCTTTTTAGG - Intergenic
1095488468 12:42708355-42708377 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1095646978 12:44558837-44558859 CTGGCTTCAGCCCCTTTTCCAGG - Intronic
1095674220 12:44897779-44897801 CTGGCTTCAGCCTCTTTTCCAGG - Intronic
1095778855 12:46037043-46037065 CTGGCTTCAGTCCCTTTTTCAGG - Intergenic
1095831490 12:46591638-46591660 CTGGTTTCAGCCCCCTTTCCAGG + Intergenic
1095920648 12:47526565-47526587 CTGTCTTCAGCCCCCTTTCCAGG + Intergenic
1095930909 12:47624306-47624328 CTTGCTTCAGCCCCCTGTCCAGG - Intergenic
1096750263 12:53754136-53754158 AAGGCTTGAGACCTCTTTCCTGG + Intergenic
1096895688 12:54819040-54819062 CTGGTTTCAGCCTCCTTTCCAGG + Intergenic
1097375835 12:58841348-58841370 CTGGCTTCAGCCTCCTTTGCAGG + Intergenic
1097412107 12:59268069-59268091 TTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1097488414 12:60234836-60234858 CTGCCTTCAGCCCGCTTTCCAGG - Intergenic
1097591602 12:61582005-61582027 CTGGATTGGGACCCCTTTCCTGG - Intergenic
1097654453 12:62343388-62343410 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1097737365 12:63196684-63196706 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1097948825 12:65403583-65403605 CTGGCTTCAGCCCACTTTCCAGG + Intronic
1097983650 12:65759859-65759881 CTGTCTTCAAAACGCTTTCCTGG - Intergenic
1098151892 12:67555687-67555709 CTGGCTTCAGCCCCCTCTCCAGG + Intergenic
1098183203 12:67869851-67869873 CTGGCTTTAGTCCCCTTTCCAGG + Intergenic
1098214762 12:68203929-68203951 CTGACTTCAGAATGCTTTCTAGG + Intronic
1098438806 12:70497181-70497203 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1098635605 12:72780363-72780385 CTGGCTTCAGCCTCCTTTCCAGG - Intergenic
1098697045 12:73572558-73572580 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1098780148 12:74676548-74676570 CTGGCTTCAACCCCCTTTCCAGG - Intergenic
1098906670 12:76169822-76169844 CTGGCTTCAGCCTTGTTTCCAGG + Intergenic
1099053482 12:77809150-77809172 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1099071391 12:78049196-78049218 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1099107874 12:78519085-78519107 CTGGATTCAGACTCCTTTCCAGG - Intergenic
1099236125 12:80084252-80084274 CTGGCTTCATCCCCCTTTCCAGG + Intergenic
1099238948 12:80116027-80116049 CTGGCTTCTGCCCCCTTTCCAGG + Intergenic
1099486269 12:83232788-83232810 CTGGCTTCAGCTGCCTTTCCAGG + Intergenic
1099492017 12:83299911-83299933 CTGGCTTCAGCCCCCTCTCCAGG - Intergenic
1099522490 12:83681702-83681724 CTGGCTTCAGCCCACTTTCCAGG - Intergenic
1099551057 12:84043734-84043756 CTGGCTTCAGACCCATTTCCAGG + Intergenic
1099554755 12:84097588-84097610 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1099572344 12:84339053-84339075 CTGGATTGAGAACTCTTTCCAGG - Intergenic
1099697493 12:86040641-86040663 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1099744997 12:86690292-86690314 CTGGCTTCAGTCCTCTCTCCAGG + Intronic
1099798032 12:87422634-87422656 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1099878412 12:88437135-88437157 CTGGCTTTAGCCCCATTTCCAGG - Intergenic
1099897534 12:88667618-88667640 TTGACTTCAGCCCTCTTTCCAGG - Intergenic
1100111047 12:91242824-91242846 TTGACTTCAGACTGCTCTCCTGG - Intergenic
1100768757 12:97898284-97898306 CTTGTTTCAGCCCCCTTTCCAGG + Intergenic
1100797978 12:98202148-98202170 CTGGCTTCAGCCCCCTTCCCAGG - Intergenic
1100896250 12:99185904-99185926 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1100918533 12:99455642-99455664 CTGGCTTTCCACCACTTTCCTGG + Intronic
1100996281 12:100304234-100304256 CTGGCTTCAGCCTCCTTTCCAGG + Intronic
1101069884 12:101062862-101062884 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1101277566 12:103219077-103219099 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1101296067 12:103424849-103424871 CTGGCTTTAGCCCCCTTTCCAGG - Intronic
1101472682 12:105013457-105013479 CTATCTTCAGCCCCCTTTCCAGG + Intronic
1101488021 12:105185235-105185257 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1102345596 12:112159168-112159190 CTGGCTTCAGCCCACTTTCCTGG + Intergenic
1103169175 12:118799118-118799140 CTGTCTTCAGCCCCCTTTCCAGG + Intergenic
1103255672 12:119539660-119539682 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1103899636 12:124296547-124296569 CTGGCTCCACTCCCCTTTCCTGG + Intronic
1104115604 12:125746419-125746441 CTGACTTCAGACTGCTGTGCTGG + Intergenic
1104115621 12:125746523-125746545 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1105552495 13:21410838-21410860 CTAGCTTCAACCCCCTTTCCAGG + Intronic
1105645809 13:22316425-22316447 CTCGTTTCAGCCCGCTTTCTAGG + Intergenic
1105737406 13:23285586-23285608 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1105769388 13:23594266-23594288 CTGGCTTCATCCCCCTTTCCAGG - Intronic
1106025788 13:25954019-25954041 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1106042122 13:26103425-26103447 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1106335100 13:28776861-28776883 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1106336606 13:28789163-28789185 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1106377461 13:29203489-29203511 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1106378826 13:29216351-29216373 CTGACTTCAGACCCCTTTCCAGG + Intronic
1106391181 13:29337120-29337142 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1106426609 13:29636636-29636658 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1106429404 13:29665736-29665758 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1106650843 13:31688408-31688430 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1106874255 13:34054747-34054769 CTGACTTCAGCTCCCTTTCCAGG + Intergenic
1106958808 13:34973813-34973835 CTGGATTCAGCCCCCTTCCCAGG + Intronic
1106983880 13:35322074-35322096 CTGGCTTCAGCCCCCTTTGCAGG + Intronic
1107289848 13:38839933-38839955 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1107314846 13:39119972-39119994 CTGGCTTCTGCCCCCTTTCCGGG + Intergenic
1107648150 13:42516446-42516468 CAGGCTTCAACCCCCTTTCCAGG - Intergenic
1107674101 13:42776928-42776950 CTAGCTTTAGCCCCCTTTCCAGG + Intergenic
1107968866 13:45622359-45622381 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1107970875 13:45641157-45641179 CTGGCTTCAGCCCCCTTTTTAGG + Intergenic
1108030101 13:46220579-46220601 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1108048823 13:46409070-46409092 CTGGCTTCAGCACCCTTTCCAGG + Intronic
1108220382 13:48227811-48227833 CTTGCCTCAGTCCTCTTTCCTGG + Intergenic
1108235024 13:48394415-48394437 CTGGCTTCAGCCCCCTTTCCGGG - Intronic
1108236813 13:48416598-48416620 CTGGCTTCAGCCCCTGTTCCAGG - Intronic
1108304586 13:49118518-49118540 CTGACTTCAGCCCCCTTTCCAGG - Intronic
1108383788 13:49879538-49879560 CTGGCTTCAGCCCCCTCTTCAGG - Intergenic
1108599843 13:51983077-51983099 CTGGCTTCAGCCACCTTTCCAGG - Intronic
1108674063 13:52721277-52721299 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1109187879 13:59291861-59291883 CTGGCTTTAGCCCCCTTTCCAGG - Intergenic
1109195908 13:59377289-59377311 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1109271266 13:60258436-60258458 CCGGCTTTAGCCCCCTTTCCGGG - Intergenic
1109541353 13:63782415-63782437 CTGGCTTCAGCACCCTTTCCAGG + Intergenic
1109615403 13:64828178-64828200 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1109731528 13:66419826-66419848 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1110115107 13:71804426-71804448 CTGGCATCAAACCTCTCTCCTGG + Intronic
1110135499 13:72062585-72062607 CTGGCTTCAGGCCCCTTTCCAGG - Intergenic
1110337257 13:74346747-74346769 CTGGCTTCAGCTGTCTTTCCAGG - Intergenic
1110389690 13:74959620-74959642 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1110824662 13:79958284-79958306 CTGGCTTCAGCCCCATTTCCAGG - Intergenic
1110968633 13:81733036-81733058 CTGGCTTCAGCCCTCTTTCCAGG + Intergenic
1111017655 13:82402490-82402512 TTAGCTTCAGCCCCCTTTCCAGG - Intergenic
1111017666 13:82402594-82402616 TTGACTTCAGACTGCTTTGCTGG - Intergenic
1111056061 13:82952763-82952785 ATGGCTTCAGGCCCCTTTCCAGG - Intergenic
1111114191 13:83754592-83754614 CTGGCTTCAGTCCCGTTTCCGGG - Intergenic
1111627931 13:90813356-90813378 CTGGCTTCAGCCCCTTTTCCAGG - Intergenic
1111635053 13:90892849-90892871 CTGGCTTCAGCTCGTTTTCCAGG - Intergenic
1112231592 13:97593383-97593405 CTGTCTTCTGCCCCCTTTCCAGG - Intergenic
1112546527 13:100376782-100376804 TTGGCTTCAGCCCCGTTTCCAGG + Intronic
1112620170 13:101046906-101046928 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1113131580 13:107042910-107042932 CTGGCTTCAGCCCCTTTTCCAGG + Intergenic
1113407801 13:110057483-110057505 CTGGGTTCTGACCTCTGTCCTGG - Intergenic
1114133581 14:19820907-19820929 CTGGCTTCAGCCCCATTTCCAGG + Intronic
1114341922 14:21754239-21754261 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1114695502 14:24623692-24623714 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1114710046 14:24768616-24768638 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1114744961 14:25136884-25136906 CTGGCTTCAGTTCCCTTTCCAGG - Intergenic
1114817644 14:25979323-25979345 CTGGCTTCAACCCCCTTTCCAGG - Intergenic
1114870131 14:26645774-26645796 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1115008205 14:28511747-28511769 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1115043085 14:28955443-28955465 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1115048716 14:29029354-29029376 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1115124172 14:29972490-29972512 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1115277088 14:31621258-31621280 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1115357143 14:32460732-32460754 TTGGCTTCAACCCCCTTTCCAGG - Intronic
1115359833 14:32488508-32488530 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1115511257 14:34139802-34139824 CTGGCTTCAGCCTTCTTTCCAGG - Intronic
1115538030 14:34391681-34391703 CTGGCTCCAGCCCCCTTTCCAGG - Intronic
1115721112 14:36162186-36162208 CTGGCTTCAGCCCTCTTTCCAGG + Intergenic
1115842766 14:37490428-37490450 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1115856284 14:37633100-37633122 CTGGCTTCAGCCCCCTTTCTAGG + Intronic
1115867254 14:37760992-37761014 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1115912181 14:38268933-38268955 CTGGCTTCATCCCCCTTTCCAGG + Intergenic
1115940354 14:38601794-38601816 ATGGCCTCAGCCCTCTTTCCAGG + Intergenic
1115974424 14:38981165-38981187 CTGGCTTTAGTCCCCTTTCCGGG + Intergenic
1115993800 14:39175244-39175266 CAGGCTTGAGACTGCTTTACAGG - Exonic
1116511905 14:45756725-45756747 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1116565382 14:46438649-46438671 CTGGCTTCAGCCCCCTTCCCAGG - Intergenic
1116572469 14:46535076-46535098 CTGGTGTCAGCCCCCTTTCCAGG + Intergenic
1116775703 14:49178639-49178661 CTGGCTTCAGCCCCGTTTCCAGG - Intergenic
1116781754 14:49244292-49244314 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1117104247 14:52382316-52382338 CCGGCTTCAGTCCCCTTTCCAGG - Intergenic
1117121045 14:52568466-52568488 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1117172366 14:53113883-53113905 CTGGCTTCAGCCCCCTTTCTAGG - Intronic
1117237955 14:53798376-53798398 TTGACTTCAGCCCCCTTTCCAGG - Intergenic
1117299278 14:54407825-54407847 CTGGCTTCAGCCCTCTTTCCAGG + Intronic
1117599977 14:57365067-57365089 CTGGCTTCGGCCCTCTTTCCAGG - Intergenic
1117617100 14:57545036-57545058 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1117710676 14:58525723-58525745 CTGGCTTCAGCCCTGTTTCGAGG - Intronic
1117821836 14:59657907-59657929 CTGGCCTCATCCCCCTTTCCAGG - Intronic
1117850091 14:59958602-59958624 CTGGCTTCAGTCCGCTTTGCAGG + Intronic
1117859352 14:60073647-60073669 CTGGCTTCAGCCCCGTTTTCAGG - Intergenic
1117930562 14:60837199-60837221 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1117932207 14:60855290-60855312 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1118516116 14:66530424-66530446 CTGGCTTAAGCCCCCTTTCCGGG + Intronic
1118544697 14:66873425-66873447 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1119018502 14:71084824-71084846 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1120137258 14:80884821-80884843 CTGGCTTCAGCCCCCTTTTAAGG - Intronic
1120201311 14:81540840-81540862 TTGGCTTCAGCCCCCTCTCCAGG - Intergenic
1120271791 14:82322067-82322089 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1120554132 14:85907933-85907955 CTGGGTTCAGCCCCCTTTCCAGG + Intergenic
1120773867 14:88411347-88411369 CTGGCTTCAGACCCCTTTCCAGG + Intronic
1120843177 14:89104800-89104822 CTGGCTTTAGCCCCCTTTCCAGG + Intergenic
1121470612 14:94151517-94151539 CTGGCTTCAGCCTCCTTTTCAGG + Intronic
1122800020 14:104224806-104224828 GTGGCTTCAGCCCATTTTCCAGG + Intergenic
1123480806 15:20629253-20629275 CTGCCTTCAGCCCCCTTTCCAGG - Intergenic
1123576649 15:21676476-21676498 CTGGCTTCAGCCCCATTTCCAGG + Intergenic
1123613271 15:22118944-22118966 CTGGCTTCAGCCCCATTTCCAGG + Intergenic
1123637205 15:22371112-22371134 CTGCCTTCAGCCCCCTTTCCAGG + Intergenic
1124084184 15:26531521-26531543 CTGGCTTCAGCCTGCTTTCCAGG - Intergenic
1124577597 15:30923593-30923615 CTGGCTGCAGAGCACTTTGCAGG - Intronic
1124893926 15:33758305-33758327 CTGGCTTCAGCCTCCTTTCCAGG - Intronic
1125216683 15:37283331-37283353 CTGGATTCAGCCCCCTTTCTAGG + Intergenic
1125219530 15:37317535-37317557 CTTGCTTCAGCCTCCTTTCCAGG - Intergenic
1125227148 15:37408318-37408340 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1125288501 15:38119885-38119907 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1125330023 15:38573545-38573567 CTGGCTTTAGACGCCTTTCCAGG + Intergenic
1125719611 15:41839051-41839073 CTGGCTTCTGCCCGCTACCCTGG - Intronic
1125784274 15:42301516-42301538 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1126500570 15:49340094-49340116 CTGGCTTCTGCCCCCTTTCCAGG + Intronic
1126554063 15:49966283-49966305 CTGACTTCAGTCCCCTTTCCAGG - Intronic
1126670388 15:51110629-51110651 CTGGCTACAGGGTGCTTTCCAGG + Intergenic
1126956196 15:53935992-53936014 CTGGATTCAGACCCCTTCCTAGG - Intergenic
1127030003 15:54851197-54851219 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1127056265 15:55135371-55135393 CTGGCTTCAGCCACCTTTCTAGG - Intergenic
1127289721 15:57559603-57559625 CTGGCTTCCCACTGCTTTTCTGG + Intergenic
1127317895 15:57815073-57815095 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1128857540 15:71031971-71031993 CTGGCTTCAGACCGCTTTCCAGG + Intronic
1128883653 15:71265618-71265640 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1129126747 15:73448161-73448183 CTGGCTTCAGCCCCCTTTTCAGG - Intronic
1129495610 15:75977299-75977321 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1129499171 15:76019309-76019331 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1129563186 15:76592984-76593006 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1130441903 15:83963181-83963203 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1130724007 15:86419626-86419648 CTGGCTTCAGCCTCTTTTCCAGG - Intronic
1130728688 15:86467449-86467471 CTGACTTCAGCCCCCTTTCCAGG + Intronic
1132096393 15:98988153-98988175 CTGGCTTCAACCCTCTTTCCAGG - Intronic
1132442901 15:101886207-101886229 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1202985517 15_KI270727v1_random:410721-410743 CTGGCTTCAGCCCCATTTCCAGG + Intergenic
1133957011 16:10453061-10453083 CTGGCTTCAGCCCCCTTTGCAGG + Intronic
1134674554 16:16080576-16080598 CTGGCTGCAGACCACACTCCTGG - Intronic
1135807538 16:25556303-25556325 CTGGCTTCAGCCCACTTTCCAGG - Intergenic
1137296297 16:47097185-47097207 CTGGTTTCAGCCCCCTTTCCAGG - Intronic
1137336498 16:47554494-47554516 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1137970009 16:52975545-52975567 CTGGCTTCTGCCCCATTTCCAGG + Intergenic
1138151529 16:54661825-54661847 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1138706474 16:58920619-58920641 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1138843675 16:60539251-60539273 CTGGTTTCAGCCCCCTTTCCAGG + Intergenic
1138886892 16:61090932-61090954 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1139953876 16:70684424-70684446 CTGGCTTCAGGCCTCTTCCGGGG + Intronic
1141246134 16:82309390-82309412 CTGGCTTCAACCCCCTTTCCAGG + Intergenic
1142022836 16:87794894-87794916 TTGGCTTCAGACCGCTGATCAGG - Intergenic
1143427162 17:6849171-6849193 CTTGCTTCAGCCCCCTTTCCAGG + Intergenic
1144434141 17:15224079-15224101 CTGGCTTCAGCCCCTTTTCTGGG + Intergenic
1145712815 17:26992501-26992523 CTGGCTTCAAACCCCCTGCCAGG - Intergenic
1146742810 17:35301311-35301333 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1146746353 17:35333904-35333926 CTGGCTTCAGCCCCATTTCCAGG + Intergenic
1146817436 17:35954065-35954087 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1147757637 17:42779493-42779515 CTGGCTGCAGGCAGCCTTCCAGG + Exonic
1148967362 17:51447135-51447157 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1149222862 17:54436011-54436033 CTGACTTCAGCCCCCTTTCCAGG - Intergenic
1149281299 17:55108385-55108407 CTGGCTTCAGCTCCCTTTCCAGG + Intronic
1150090743 17:62322772-62322794 CTGCCTTCACCCCCCTTTCCAGG - Intergenic
1150545756 17:66155559-66155581 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1150884612 17:69070753-69070775 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1151064207 17:71131971-71131993 CTGGTTTCAGCCCCCTTTCCAGG + Intergenic
1153059401 18:980072-980094 CTGGCTTCAGCCCTTTTTCCAGG + Intergenic
1153313434 18:3700101-3700123 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1153562264 18:6383288-6383310 CTGGCTTCACTCCCCTTTCCAGG + Intronic
1153702592 18:7711495-7711517 CTGGCTTCAGCCCCTTTTCCAGG - Intronic
1153717871 18:7869174-7869196 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1155006668 18:21735537-21735559 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1155114204 18:22748796-22748818 CTGGCTTCAGCCCCCTTTTCAGG - Intergenic
1155384915 18:25266939-25266961 CTGGCTTCAGCCCACTTTCCAGG - Intronic
1155395300 18:25380249-25380271 CTGGCTTCAGCCCCCTTCCCAGG - Intergenic
1155857362 18:30850250-30850272 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1156188396 18:34690122-34690144 CTGGCTTCAGCCCCCTTCCCAGG + Intronic
1156230777 18:35152183-35152205 CTGGCTTCAGCCACCTTTCTAGG + Intergenic
1156415153 18:36880007-36880029 CAGGCTTCAGCTCCCTTTCCAGG + Intronic
1156626884 18:38920229-38920251 CTGGCTTCAGTCCCCTTTCTAGG + Intergenic
1156694725 18:39753154-39753176 CTGGCTTCAGCCCCCTTCCAAGG - Intergenic
1156979306 18:43265792-43265814 TTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1157066581 18:44357157-44357179 CTGGCTTTAGCCCCCTTTCCAGG + Intergenic
1157068074 18:44374983-44375005 CTGGCTTCAGCCCCATTTCCAGG - Intergenic
1157071726 18:44416384-44416406 CTGGCTTCAGCTCCCTTTCCAGG - Intergenic
1157178875 18:45477857-45477879 CTGACTTCAGACTGCTGTGCTGG + Intronic
1157178893 18:45477961-45477983 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1157695124 18:49716431-49716453 CTGGCTTTAGCCCCTTTTCCAGG + Intergenic
1158373152 18:56832003-56832025 CTGGCTTCAGCCCTCTTTCCAGG - Intronic
1158659367 18:59372095-59372117 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1158853352 18:61517782-61517804 CTGGATTCAGCCCCTTTTCCAGG - Intronic
1159254702 18:65931098-65931120 CTGGCTTCAGTTGCCTTTCCAGG - Intergenic
1159385989 18:67726012-67726034 TTAGCTTCAGCCCCCTTTCCAGG + Intergenic
1159562173 18:70007420-70007442 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1159581305 18:70236880-70236902 CTGGCTTTAGCCCCCTTTTCAGG - Intergenic
1159661249 18:71098094-71098116 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1159690613 18:71482986-71483008 CTGGCTTCAGCCCGTTTTCCAGG + Intergenic
1159901746 18:74053415-74053437 CTGGCTTCAGCCCCCTTTTCAGG - Intergenic
1160642031 19:146942-146964 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1161097758 19:2403072-2403094 CTGTCCTCAGGCCGCTGTCCAGG + Exonic
1161433216 19:4246458-4246480 CTGGATCCGGACCCCTTTCCTGG + Intergenic
1161483351 19:4521781-4521803 CTGTCCTCTGACCGCATTCCTGG - Intergenic
1162748551 19:12813430-12813452 CTGACTCCAGGCCGCGTTCCAGG - Exonic
1163989857 19:20988353-20988375 CGGGCTTCAACCCCCTTTCCAGG - Intergenic
1164093019 19:21977745-21977767 CTGGCTTCAGCCCTCTTTCCAGG - Intronic
1164112718 19:22184532-22184554 CTGGCTTCAGCCTTCTTTCCAGG - Intronic
1165254611 19:34568193-34568215 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1165269875 19:34696819-34696841 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1165970424 19:39624254-39624276 CTGGCTTCAGTCCCCTTTACAGG + Intergenic
1166836053 19:45668755-45668777 CGGGCGTTAGACCGATTTCCAGG + Intronic
1167974143 19:53210280-53210302 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1168474345 19:56665087-56665109 CTGGCTCTGGACAGCTTTCCTGG + Exonic
1168530879 19:57127755-57127777 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1168606256 19:57762404-57762426 CTGGATCAAGACCGCTTTTCGGG + Intergenic
924967597 2:92469-92491 CTGGCTTCAGCTCCCTTTCCAGG - Intergenic
925484528 2:4313321-4313343 CTGGCTTCAGTCTCTTTTCCAGG + Intergenic
925692325 2:6537833-6537855 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
925729180 2:6905133-6905155 CTGGCTTCAACCCCCTTTCCAGG + Intergenic
926483474 2:13427783-13427805 CTGGCTTCAGGCCCCTTTCCAGG + Intergenic
926508567 2:13745337-13745359 CTGGCTACAGACTTCTTTCCAGG - Intergenic
926944001 2:18168170-18168192 CTGGCTTCAGCCCTCTTTCCAGG + Intronic
927021343 2:19020455-19020477 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
927117133 2:19916401-19916423 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
928576735 2:32663153-32663175 CTGGCTTCAGGCCCCTTTCCAGG + Intronic
928750620 2:34466669-34466691 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
928830524 2:35477734-35477756 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
928880148 2:36088547-36088569 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
928932492 2:36638154-36638176 CTGTCTTTGGAACGCTTTCCAGG - Intronic
929062925 2:37941871-37941893 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
929333560 2:40712911-40712933 CTGGCTTCACCACCCTTTCCAGG + Intergenic
929837998 2:45426012-45426034 CTGGCTCCAGCCCCCTTTCCAGG - Intronic
930359305 2:50358243-50358265 CTGGCTTCATCCCCCTTTCCAGG - Intronic
930439901 2:51391837-51391859 CTGGTTTCAGCCCCCTTTCCAGG - Intergenic
930476674 2:51891363-51891385 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
930925717 2:56816292-56816314 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
931212110 2:60207308-60207330 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
931480370 2:62633448-62633470 CTGGCTTCAGCCCCCTTCCAGGG - Intergenic
931538646 2:63304761-63304783 CTGCCTTCAGCCCCCTTTCCAGG - Intronic
931566422 2:63620185-63620207 CTGGCTTTAGCCCCCTTTCCAGG - Intronic
931814813 2:65890130-65890152 CTGGCACCAGCCCCCTTTCCAGG - Intergenic
931886721 2:66625954-66625976 CTGGCTTCAGCCCCGTTTCCAGG + Intergenic
932051790 2:68405359-68405381 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
932159832 2:69449406-69449428 CTGGATTCAGACTTATTTCCTGG + Intergenic
932511826 2:72300499-72300521 CTGGCTTCAGCCTCCTTTCCAGG + Intronic
932899484 2:75681607-75681629 CTGTCTTCAGCCCCTTTTCCAGG - Intronic
932913866 2:75834153-75834175 CTGGCTTCAGCCTCCTTTCCAGG - Intergenic
932938977 2:76139689-76139711 CTGGCTTCAGACCCCTTTCCAGG + Intergenic
933107854 2:78356094-78356116 CTGGCCACAGAGTGCTTTCCAGG - Intergenic
933317857 2:80736863-80736885 TTGGCTTCAGTCCCCTTTCCAGG - Intergenic
933324220 2:80815295-80815317 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
933413225 2:81951182-81951204 TTGGCTTCAGCCCCCTTTCCAGG + Intergenic
933488305 2:82950522-82950544 CTGGATTCAGCCCCCTTTCCAGG + Intergenic
934702712 2:96454864-96454886 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
935325814 2:101935831-101935853 CTGGCTTCAGCCTCCTTTCCAGG - Intergenic
935399418 2:102644477-102644499 CTAGCTTCAGCCCCCTTTCCAGG - Intronic
935567967 2:104629678-104629700 CTGCCTTCAGCCCCTTTTCCAGG + Intergenic
935814559 2:106835118-106835140 CTGGCTTCAGGCTGGTTTCTAGG - Intronic
935852236 2:107235477-107235499 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
935961470 2:108429607-108429629 CTGGCTTCAACCCTTTTTCCAGG - Intergenic
936640293 2:114304280-114304302 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
937143110 2:119618749-119618771 CTGGCTTCAGTCCCCTTTCCAGG - Intronic
937465044 2:122125108-122125130 CTGGCTTCAGTCCCCCTTCCAGG + Intergenic
937562703 2:123244924-123244946 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
937573494 2:123391837-123391859 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
937679288 2:124626721-124626743 CTGGCTACAGCCCCCTTTCCAGG - Intronic
937807264 2:126160935-126160957 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
937893278 2:126956761-126956783 CTGGCTTCAGCCCCCTTTTCAGG - Intergenic
938568127 2:132539039-132539061 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
939033248 2:137101552-137101574 CCGCCTTCAGCCCCCTTTCCAGG - Intronic
939180193 2:138795009-138795031 CTTGATTCAGCCCGCTTCCCAGG + Intergenic
939470640 2:142615871-142615893 CTGGCTTCAGCCTCCTTTCCAGG - Intergenic
939640870 2:144638647-144638669 CTGGCTTCAGCCCCCTTTTCAGG + Intergenic
939652786 2:144785440-144785462 CTGGCTTCGGCCCCCTTTCCAGG - Intergenic
939687171 2:145213801-145213823 CTGGCTTTAGCCCCCTTCCCAGG + Intergenic
939840589 2:147182671-147182693 CTGGCTTCAGCCCTCTTTCCAGG - Intergenic
939876713 2:147586436-147586458 CTGGCTTCAACCCCCTTTCCAGG + Intergenic
939937783 2:148313618-148313640 CTGACTTCAGCCCCCTTTCCAGG + Intronic
939941980 2:148362149-148362171 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
940030574 2:149257627-149257649 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
940054554 2:149500191-149500213 ATGGCTTCAGCCCCCTTTCCAGG + Intergenic
940114389 2:150192339-150192361 CTGGCTTCATCCCCTTTTCCAGG - Intergenic
940124826 2:150311456-150311478 CTGGCTTCAGCCTGTTTTCCAGG - Intergenic
940594027 2:155767048-155767070 CTGTCTTTAGCCCCCTTTCCAGG + Intergenic
940602584 2:155880371-155880393 CTGGCTTCAGCCCTCTTTCCAGG - Intergenic
940614962 2:156038470-156038492 CTGGATTCAGCCCTCTTTCCAGG - Intergenic
940821383 2:158359837-158359859 CTGGTTTCAGCCCCCTTTCCAGG - Intronic
940925154 2:159356151-159356173 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
940999000 2:160181151-160181173 CTGGCTTCAGCCCCCTTTTCAGG - Intronic
941076353 2:161010451-161010473 CTGGCTTCAGCCCCTTTTCCAGG - Intergenic
941119569 2:161513350-161513372 CTGGCTTCAGCCCTTTTCCCAGG - Intronic
941239408 2:163017600-163017622 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
941276565 2:163497850-163497872 CTGGCTTCCACCCCCTTTCCAGG - Intergenic
941333923 2:164216299-164216321 CTAGCTCCAGACGGCTTCCCTGG + Intergenic
941478030 2:165971946-165971968 CTAGCTTCAGCCCCCTTTCCAGG - Intergenic
941518743 2:166511556-166511578 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
941565371 2:167099487-167099509 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
941571532 2:167176095-167176117 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
941845271 2:170126066-170126088 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
942010884 2:171761512-171761534 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
942411017 2:175709281-175709303 CTGGCTTCAGCCCCATTTCCAGG - Intergenic
942953715 2:181750516-181750538 CTGGTGTCAGCCCCCTTTCCGGG + Intergenic
943074666 2:183179529-183179551 TTGGCTTCAGCCCCCTTTCCGGG + Intergenic
943085022 2:183300781-183300803 CTGGCTTCAGCCCTTTTTCCAGG + Intergenic
943094868 2:183416767-183416789 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
943105683 2:183543707-183543729 CTGGCTTCAGCCCCCCTTCCAGG - Intergenic
943129947 2:183842037-183842059 CTGGCTTCCGCCCCCTTCCCAGG - Intergenic
943147707 2:184066135-184066157 CTGGCTTCATCCCCCTTTCCAGG + Intergenic
943240397 2:185376999-185377021 CTGACTTCAGCCCCCTTTCCAGG + Intergenic
943350691 2:186793166-186793188 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
943352505 2:186812250-186812272 CTGGCTTTAGCCCCCTTTCCAGG - Intergenic
943408784 2:187520126-187520148 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
943409774 2:187532742-187532764 CTGGCTTAAGCCCCCTTTCCAGG - Intronic
943512291 2:188840782-188840804 CTGGCTTCAGCTCCCTTTCTAGG - Intergenic
943660461 2:190554318-190554340 CTGGCTTCAGTCTCCTTTCCAGG - Intergenic
943836799 2:192524636-192524658 CTGGCTTCAGCCGCCTTTCCAGG - Intergenic
944167934 2:196743072-196743094 CTGGATTCAGACCCCTTCCTAGG + Intronic
944267884 2:197748397-197748419 CTGGCTTCAGCTCCCTTTCCAGG - Intronic
944292015 2:198018394-198018416 CTGGCTTCAGCCCCTATTCCAGG - Intronic
944615792 2:201458826-201458848 CTGGTTTCAGACTGTTTTTCAGG - Exonic
944635392 2:201671230-201671252 CTGGCTTCAGCCCCTTTTCCAGG - Intronic
944764332 2:202849295-202849317 CTGGCCTCAGCCCCCTTTCCAGG - Intronic
945329746 2:208525506-208525528 TTGGCTTCAGCCCCCTTTCCAGG + Intronic
945467021 2:210181479-210181501 CTGGCTTCAGCCTCTTTTCCAGG - Intergenic
945486921 2:210407169-210407191 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
945927384 2:215819488-215819510 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
946065337 2:216982675-216982697 CTGGCTTCAGCCCTCTTTCCAGG + Intergenic
946912970 2:224485281-224485303 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
947033477 2:225824706-225824728 CTGGCTTTAGCCCGCTTTCCAGG - Intergenic
947225868 2:227839666-227839688 CTGGCTTCAGCCCCCTCTCCAGG + Intergenic
948869288 2:240790188-240790210 CTGGGTTCAGACAGTGTTCCAGG - Intronic
948953195 2:241268476-241268498 CTGGCTACTGACCGTTTTGCTGG - Exonic
1169320069 20:4625300-4625322 CTAGCTTCAGCCCCCTTTCCAGG + Intergenic
1169397063 20:5241697-5241719 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1169960362 20:11152738-11152760 CTGGCTTCAATCCCCTTTCCAGG + Intergenic
1169984123 20:11423101-11423123 CTGCCTTCAGCCCCCTTTCCAGG + Intergenic
1170133889 20:13052554-13052576 CTGGCTTCAACCCCCTTTCCAGG - Intronic
1170167920 20:13381053-13381075 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1170229415 20:14028399-14028421 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1170266403 20:14470901-14470923 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1170294216 20:14806603-14806625 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1170454580 20:16520191-16520213 CTGGCTTCAGCTTCCTTTCCAGG - Intronic
1170720461 20:18873377-18873399 CTGGCTTCGGCCTCCTTTCCAGG + Intergenic
1171000832 20:21413997-21414019 CTAGCTTCAGCCCCCTTTCCAGG - Intergenic
1171513421 20:25706679-25706701 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1173318661 20:41968150-41968172 CTGGCTTCAACCCCCTTTCCAGG + Intergenic
1173401257 20:42728038-42728060 CTGGCTCCAGACGACCTTCCAGG + Intronic
1173751182 20:45478138-45478160 CTAGCTTCAGCCCCCTTTCCAGG + Intronic
1174477960 20:50810682-50810704 CTGGGTTCACGCCGTTTTCCTGG + Intronic
1175040936 20:56050029-56050051 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1176891768 21:14327328-14327350 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1177050263 21:16224766-16224788 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1177129648 21:17240634-17240656 CTGGCTTCAGCCCTCTTTCCAGG - Intergenic
1177184210 21:17775719-17775741 CTGGTTTCAGCCCCCTTTCCAGG + Intergenic
1177540972 21:22493659-22493681 CTGGCTTCAGCCTCCTTTCCAGG - Intergenic
1177694558 21:24555052-24555074 CTGGCTTCAACCCACTTTCCAGG - Intergenic
1178020739 21:28405680-28405702 TTTGCTTCTGACCTCTTTCCTGG + Intergenic
1178393541 21:32219638-32219660 CTGGCTTCAGCCCTCTTTCCAGG - Intergenic
1178864467 21:36316653-36316675 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1180654965 22:17412696-17412718 ATGGCTTCAAAGAGCTTTCCAGG - Intronic
1181329348 22:22077128-22077150 TTGGCCTCTGACAGCTTTCCTGG - Intergenic
1182204470 22:28609750-28609772 CTGGCTTCAGCCTCCTTTCCAGG - Intronic
1182870295 22:33640597-33640619 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1182952517 22:34390788-34390810 CTGGCTTCAGGCCCCTTTCCAGG + Intergenic
1183021513 22:35030922-35030944 CTGGCTTCAGCTCCCTTTCCAGG + Intergenic
1183182734 22:36271872-36271894 CTGGCTTCAGCCCTCTTTCCAGG + Intergenic
949154986 3:816663-816685 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
949173900 3:1035104-1035126 CTAGCTTCAGCCCCCTTTCCAGG + Intergenic
949580629 3:5384253-5384275 CTGGCTTCAGTCCTCTTTCCAGG + Intergenic
949583345 3:5412683-5412705 CTGGCTTCAACACCCTTTCCAGG - Intergenic
949641057 3:6036364-6036386 CTGGCTTCAACCTCCTTTCCAGG + Intergenic
950479023 3:13233405-13233427 CTGGCTTCAGGCCCCTGTTCTGG + Intergenic
950561998 3:13736353-13736375 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
950597478 3:13997257-13997279 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
950610174 3:14121682-14121704 CTGGCTTTAGATCTCTTTCTTGG - Intronic
951254512 3:20433091-20433113 CTTGCTTCAGCCCCCTTTCCAGG + Intergenic
951310887 3:21125018-21125040 CTGGGTTCAGCACCCTTTCCAGG - Intergenic
951503695 3:23418035-23418057 CTTGCTTCAGCCCCTTTTCCAGG + Intronic
951629135 3:24699446-24699468 CTGGCTTTAGCCCCCTTTCCAGG + Intergenic
951676455 3:25247298-25247320 CTGTCTTCAGCCCCTTTTCCAGG + Intronic
951687615 3:25362451-25362473 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
951741653 3:25931632-25931654 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
951777273 3:26324054-26324076 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
951795507 3:26533978-26534000 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
953047215 3:39304691-39304713 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
953102372 3:39842437-39842459 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
953264263 3:41370807-41370829 CTGGCTTCAGCCCCCTTTTCAGG - Intronic
953286626 3:41616797-41616819 CTGGCTTCAGCCCCCTTCCCTGG - Intronic
953315846 3:41925566-41925588 CTGGCTTTGGCCCCCTTTCCAGG - Intronic
953555803 3:43946036-43946058 CTGGCTTCAGCCCCTTTTCCAGG + Intergenic
954508215 3:51097583-51097605 CTGGCTTCAGTCCCCTTTCCAGG + Intronic
954510516 3:51120943-51120965 CTGGCTTCAGCTTCCTTTCCAGG + Intronic
954524929 3:51261575-51261597 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
954531052 3:51320488-51320510 CTGGCTTTAGCCCCCTTTCCAGG - Intronic
955175130 3:56606253-56606275 CTGGCTTCCGCCCCCTTTCCAGG + Intronic
955414316 3:58678573-58678595 CTGGCTTCATCCCCCTTTCCAGG + Intergenic
955439738 3:58942737-58942759 CTGGCTTTAACCCCCTTTCCAGG - Intronic
955447789 3:59032361-59032383 CTGGCTTCAGCCCCCTTTCCCGG - Intronic
955657852 3:61263786-61263808 CTGGCTTCATCCCCCTTTCCAGG + Intergenic
956220063 3:66893189-66893211 CTGGCTTCAGCTCCCTTTCCAGG - Intergenic
956242148 3:67142394-67142416 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
956243382 3:67154435-67154457 CTGCCTTCAGCCCCCTTTCCAGG - Intergenic
956300248 3:67764451-67764473 CTGGCTTCATCCCCCTTTCCAGG + Intergenic
956355700 3:68390017-68390039 CTTGCTTCACCCCCCTTTCCAGG - Intronic
956383083 3:68686433-68686455 TTGGCTTCAGCCCCCTTTCCGGG + Intergenic
957011255 3:75008546-75008568 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
957249647 3:77756907-77756929 CTGGCTTCAGCCCTTTTTCCAGG - Intergenic
957256636 3:77845353-77845375 CTGGCTTCAGCCTTCTTTCCAGG + Intergenic
957474825 3:80709593-80709615 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
957695692 3:83635876-83635898 CTGGTTTCAGCCCTCTTTCCAGG - Intergenic
957747703 3:84366244-84366266 CTGGCTTCAGCCTCTTTTCCAGG + Intergenic
957776473 3:84761173-84761195 CTGGCTTCAGCCCCCTTTGCAGG - Intergenic
958520935 3:95184730-95184752 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
958586227 3:96091353-96091375 CTGGCTTCAGCCCCTTTTCCAGG - Intergenic
958650637 3:96931818-96931840 CTGGATTCAGCCCGCTTCCTAGG + Intronic
958694588 3:97511154-97511176 ATGGCTTCAGCCCCCTTTCCAGG + Intronic
959025630 3:101236879-101236901 CTGGCTTCAGCCTCCTTTCCAGG - Intronic
959093091 3:101925020-101925042 CTGACTTCAGACCCCTTTCCAGG + Intergenic
959278198 3:104304475-104304497 CTGGCTTCAGCCTGCTTTCCAGG - Intergenic
959291869 3:104485111-104485133 CTGGCTTCAGCTCCCTTTTCAGG - Intergenic
959345594 3:105191146-105191168 CTAGCTTCAGCCCCCTTTCCAGG + Intergenic
959505896 3:107156168-107156190 CTGACTTCAGCCCCCTTTCCAGG - Intergenic
959734958 3:109648062-109648084 CTGGTTTCAGCCCCCTTTCCAGG - Intergenic
959842844 3:110998785-110998807 CTGGCTTCAGCTTCCTTTCCAGG - Intergenic
959881223 3:111447083-111447105 CTGGCTTCAGTCCCTTTTCCAGG + Intronic
960075951 3:113485242-113485264 CTAGCTTCAGCCCCCTTTCCAGG - Intronic
960177256 3:114532150-114532172 CTGGCTTCAGCCCCCATTCCAGG - Intronic
960378145 3:116928263-116928285 CTGGCTTTAGCCGCCTTTCCAGG + Intronic
960760112 3:121063968-121063990 CTGGCTTCAGCCCACTTTCCAGG + Intronic
960773175 3:121217159-121217181 CTGGCTTCAGCCCCCTTTCCTGG + Intronic
960827865 3:121811429-121811451 TTGGTTTCAGACCCCTTTCCAGG - Intronic
960840526 3:121954345-121954367 CTGGCTTGGGACCCCTTTCTGGG - Intergenic
960937114 3:122911150-122911172 GTGGCCTCAGAGCCCTTTCCAGG - Intronic
961051312 3:123749444-123749466 CTGTCTTCAGATAGCCTTCCAGG + Intronic
961310568 3:125996742-125996764 CTGGCTTCAGCACCCTTTCCAGG - Intergenic
961839799 3:129699665-129699687 CTGGATTGGGACCCCTTTCCTGG + Intronic
961977496 3:131042274-131042296 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
961998272 3:131269245-131269267 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
962634800 3:137319564-137319586 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
962640152 3:137377282-137377304 CTGGTTTCAGCCCTCTTTCCAGG + Intergenic
962642376 3:137400799-137400821 CTGGCTTCAGCCTCCTTTCCAGG + Intergenic
962666022 3:137654369-137654391 CTGGCTTCAGCCCCCTTTCTGGG - Intergenic
962668372 3:137679508-137679530 CTGGCTTCAGCCCCCTTTCCGGG - Intergenic
962765691 3:138560535-138560557 CTGGCTTCAGTCCCCTTTCCAGG - Intronic
963004064 3:140709656-140709678 CTGGCTACAGATCCCTCTCCAGG - Intergenic
963013984 3:140803263-140803285 CTAGCTTCAGCCCCCTTTCCAGG + Intergenic
963027424 3:140933547-140933569 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
963401759 3:144806980-144807002 CTGGCTGTAGCCCCCTTTCCAGG + Intergenic
963629312 3:147713138-147713160 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
963998580 3:151739988-151740010 CTGACTTCAGCCCCCTTTCCAGG + Intronic
964010347 3:151885305-151885327 CTGGCTTCAGCCGCCTTTCCAGG - Intergenic
964049499 3:152373271-152373293 CTGGCTTCAGTTCCCTTTCCAGG + Intronic
964053077 3:152419775-152419797 CTGGCTTCAGCCCTCTTTCCAGG - Intronic
964053279 3:152421326-152421348 CTGGCTTCAGCCGCCTTTCCAGG - Intronic
964232462 3:154486943-154486965 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
964371384 3:156004064-156004086 CTGGCTTTAGCCCCCTTTCCAGG + Intergenic
964378045 3:156069126-156069148 CTGGCTTCAGCCCCGTTTCCAGG + Intronic
964904814 3:161707252-161707274 CTGGCTTCAGCCCCCTTCCCAGG - Intergenic
965091085 3:164163389-164163411 CTGGCTTCAGCCTCCTGTCCAGG + Intergenic
965497247 3:169413550-169413572 CTGGCTTCAGCCCCCTTTGCAGG - Intronic
965511085 3:169568381-169568403 CTGGCTTCAGCCCCTTTTCCAGG - Intronic
965618747 3:170621632-170621654 CTGGCTTCAGCCCTCTTTCCAGG + Intronic
965801324 3:172496890-172496912 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
965880436 3:173382313-173382335 CTGACTTCAGCCCCCTTTCTAGG - Intergenic
966251059 3:177865871-177865893 CCAGCTTCAGCCCCCTTTCCAGG - Intergenic
966255119 3:177908634-177908656 CTAGCTTGAGCCCCCTTTCCAGG - Intergenic
966291177 3:178361270-178361292 CTGACTTCAGTCCCCTTTCCAGG - Intergenic
966296809 3:178433198-178433220 CTGTCTTCACACTGATTTCCTGG - Intronic
966309385 3:178576505-178576527 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
966533322 3:181004486-181004508 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
966561473 3:181325216-181325238 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
966637937 3:182156684-182156706 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
967181520 3:186909514-186909536 CAGGCTTCAGCCCCCTTTCCAGG + Intergenic
967343560 3:188427889-188427911 CTGGCTTCAGTCCCCTTTCCAGG + Intronic
967562682 3:190934997-190935019 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
967715562 3:192758209-192758231 CTGGTTTCAGCCCCCTTTCCAGG - Intronic
968446639 4:655495-655517 ATGGCTTCAGCCTGCTTTCTAGG - Intronic
968829126 4:2923115-2923137 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
969164833 4:5298766-5298788 CTCGCTTCAGTCCCCTTTCCAGG + Intronic
969909209 4:10428053-10428075 CTGGCTTCAGCCTCCTTTCCAGG + Intergenic
970185387 4:13446345-13446367 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
970304701 4:14719105-14719127 CTGGCTTCAGCCTCCTTTCCAGG - Intergenic
970412026 4:15818016-15818038 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
970679353 4:18489331-18489353 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
970727161 4:19060312-19060334 CTGGCCTCAGCCCCCTTTCCAGG - Intergenic
970784481 4:19780058-19780080 TTGGCTTCAGCCCCATTTCCAGG + Intergenic
971430082 4:26556498-26556520 CTGGCTTCAGCCACCTTTCCAGG + Intergenic
971647665 4:29229777-29229799 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
971673625 4:29595653-29595675 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
971883224 4:32409547-32409569 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
972219301 4:36935783-36935805 CTGGCCTCAGCCCCCTTTCCAGG - Intergenic
972372479 4:38438190-38438212 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
972743295 4:41909486-41909508 CTGGCTTCAGCCCCCTTTCCTGG + Intergenic
973081878 4:46003252-46003274 CTGGTTTCATCCCTCTTTCCAGG + Intergenic
973272981 4:48280076-48280098 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
973321799 4:48817590-48817612 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
973562627 4:52151661-52151683 CTGGCTTCAGCCCCTTTTCCAGG - Intergenic
973568006 4:52207757-52207779 CTGGCTTCAGCCCTCTTCCCAGG - Intergenic
973629086 4:52802121-52802143 CTAGCTTCAGCCCCCTTTCTAGG - Intergenic
973629101 4:52802225-52802247 TTGGCTTCAGACTGCTGTGCTGG - Intergenic
973660881 4:53105349-53105371 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
973715244 4:53669794-53669816 CTGGCTTCAGTCCTCTTTCCAGG + Intronic
974251799 4:59394481-59394503 CTGGATTCAGCCCCCTTTCCAGG + Intergenic
974263998 4:59560583-59560605 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
974302036 4:60081447-60081469 TTGGCTTCAGCCCCCTTTCCAGG - Intergenic
974326324 4:60419338-60419360 CTGACTTCAGCCCCCTTTCCAGG + Intergenic
974491646 4:62571891-62571913 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
974560067 4:63506108-63506130 CTGGTTTCAGCCCCCTTTCCAGG - Intergenic
974792978 4:66714058-66714080 CTGGCTTCAACCTGCTTTCCAGG - Intergenic
974813941 4:66981907-66981929 ATGGCTTCAGCCCCCTTTCCAGG - Intergenic
974851806 4:67412715-67412737 CTGGCTTCAGCCTCCTTTTCAGG + Intergenic
974946644 4:68536371-68536393 CTGGCTTCAGTCCCCTTTGTAGG + Intergenic
975104099 4:70548760-70548782 CTAGCTTCAACCCCCTTTCCAGG - Intergenic
975149438 4:71004959-71004981 CTGGCTTCAGCCCCCTTTCTAGG + Intronic
975177890 4:71308892-71308914 CTGGCTTCAGCCCCCTTTCTAGG - Intronic
975212994 4:71722665-71722687 CTGGCTTCAGCCCTTTTTCCAGG + Intergenic
975307585 4:72866950-72866972 CTGGCTTCAGCCCCCTTTTTAGG - Intergenic
975466366 4:74713938-74713960 CTGGCTTCGGCCCCCTTTCCAGG + Intergenic
975479318 4:74860026-74860048 CTTGCTTCAGCCGCCTTTCCAGG - Intergenic
975533076 4:75420909-75420931 CTGGCTTCAGTCCCCTCTCCAGG + Intergenic
975620355 4:76290614-76290636 CTGGCTTCAGTCCTCTTTCCAGG + Intronic
975638766 4:76478140-76478162 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
975764662 4:77654908-77654930 CTGGCTTCAGCCCGCTTTCCAGG - Intergenic
976006779 4:80439706-80439728 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
976061282 4:81130961-81130983 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
976065536 4:81183656-81183678 CTGGCTTCAGCCCCCTTTTCAGG - Intronic
976114833 4:81715408-81715430 CTGGCTTCATCCCCCTTTTCAGG - Intronic
976169232 4:82285814-82285836 CTGTCTTCTGCCCACTTTCCTGG - Intergenic
976363041 4:84202774-84202796 CTGGCTTCAGTCTCCTTTCCAGG - Intergenic
976394891 4:84545116-84545138 CTGGCTTCAGCACCGTTTCCAGG - Intergenic
976438271 4:85043808-85043830 CTGGCTCCAGCCCCTTTTCCAGG - Intergenic
976439264 4:85054961-85054983 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
976534351 4:86193732-86193754 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
976655945 4:87489067-87489089 CTGGCTTCAGCCACATTTCCAGG + Intronic
976715918 4:88122328-88122350 CTGGCTTCAGCCCCTTTTCCAGG - Intronic
976809954 4:89090003-89090025 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
977046888 4:92079148-92079170 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
977154453 4:93555271-93555293 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
977185674 4:93932775-93932797 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
977425519 4:96863032-96863054 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
977438988 4:97038073-97038095 CTGGCTTCAGCTCCCTTTCCAGG + Intergenic
977467780 4:97403335-97403357 CAAGCTTCAGCCCCCTTTCCAGG + Intronic
977500251 4:97828556-97828578 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
977513785 4:97995070-97995092 CTGGCTTTCTACCACTTTCCTGG - Intronic
977536294 4:98260345-98260367 CTGGCTTCGGTCCTCTTCCCTGG - Intergenic
977631478 4:99248072-99248094 TTGACTTCAGACTGCTTTCCTGG + Intergenic
977723504 4:100267750-100267772 CTGGCTTCAGCTCCCTTTCCAGG + Intergenic
977774406 4:100900608-100900630 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
977792919 4:101128910-101128932 CTGGTTTCAGCCCCCTTTCCAGG - Intronic
977887864 4:102273108-102273130 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
977897839 4:102384301-102384323 CTGGCTTCAGCTTCCTTTCCAGG + Intronic
977986155 4:103385558-103385580 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
977994435 4:103484919-103484941 CTGGCTTAAGCCCCCTTTCCAGG - Intergenic
978078902 4:104568128-104568150 CTGGCTTCAGCCCTGTTTCCAGG + Intergenic
978108249 4:104930722-104930744 CTGACTTCAGCCCCCTTTCCAGG - Intergenic
978179553 4:105776315-105776337 CTGGCTTCAACCCCCATTCCAGG + Intronic
978186082 4:105858387-105858409 CTGGCTTCTGTCCCCTTTCCAGG + Intronic
978278350 4:106978717-106978739 CTGGCTTCAGCCCCCTTTGCAGG + Intronic
978664277 4:111164191-111164213 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
978699787 4:111628430-111628452 CTGGTTTCAGCCCCCTTTCCAGG + Intergenic
978845583 4:113269252-113269274 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
979012305 4:115387410-115387432 CTGGCTTCAGCCCTCTTTCCAGG - Intergenic
979022889 4:115525260-115525282 CTAGCTTCAGCCCCCTTGCCAGG + Intergenic
979115260 4:116815260-116815282 CTGGCTTCAGCCCCCTTTCGAGG - Intergenic
979119775 4:116883332-116883354 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
979417437 4:120460819-120460841 CTGGCTTCATCCCCCTTTCCAGG - Intergenic
979421372 4:120509271-120509293 CTGGCTTCAGCTCCCTTTCCAGG - Intergenic
979457574 4:120944230-120944252 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
979668301 4:123336662-123336684 CTGGCTTCAGCCGCCTTTACAGG + Intergenic
979705345 4:123713741-123713763 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
979819404 4:125151831-125151853 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
979965999 4:127077318-127077340 CTGGCTCCAGCCCCCTTTCCTGG + Intergenic
980148727 4:129021353-129021375 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
980151685 4:129055750-129055772 CTGGCTTCAGCTCCCTTTCCAGG + Intronic
980330408 4:131403562-131403584 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
980494192 4:133570282-133570304 CTGGCTTTAGCCTTCTTTCCAGG + Intergenic
980583662 4:134786583-134786605 CTGGCTTCCACCCCCTTTCCAGG + Intergenic
980633944 4:135473922-135473944 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
980687837 4:136253528-136253550 CTGACTTCAGCCCCCTTTCCAGG - Intergenic
980769310 4:137351041-137351063 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
980855210 4:138431586-138431608 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
980870577 4:138607039-138607061 CTGGCTCCAGCCTGCTCTCCTGG + Intergenic
980888134 4:138785499-138785521 TTGACTTCAGACTGCTGTCCTGG + Intergenic
980888147 4:138785603-138785625 CTGGCTTCAGCCCTCTTTCCCGG + Intergenic
981131557 4:141162965-141162987 CTGGCTTCAGCCCCCTTCCAGGG - Intronic
981134004 4:141189876-141189898 CTGGCTTCAGCCCCGTTTCAGGG + Intronic
981273154 4:142867883-142867905 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
981411236 4:144435091-144435113 CTGGCTTCAGCCCTCTTTCTAGG - Intergenic
981443455 4:144809043-144809065 CTGGCTTCTGCCCCCTTTCCAGG - Intergenic
981481493 4:145243458-145243480 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
981629673 4:146804397-146804419 CTGGCTTCAGCCTCCTTTCCAGG - Intronic
981662497 4:147184046-147184068 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
981671527 4:147292634-147292656 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
981789649 4:148521883-148521905 CTGGGTTCAGCCCCCTTTCCAGG + Intergenic
981794966 4:148585574-148585596 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
981846498 4:149176012-149176034 CTGGCTTCAGCCCCCTTTGCAGG - Intergenic
981859870 4:149341512-149341534 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
981885316 4:149666590-149666612 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
981939912 4:150271378-150271400 CTGGCTTCAGCCTCCTTTCCAGG - Intronic
982167672 4:152629491-152629513 CTGGCTCCACACCTTTTTCCTGG + Intronic
982284604 4:153722176-153722198 ATGTCTTCAGTCCCCTTTCCAGG + Intronic
982298982 4:153859709-153859731 CTGGCTTCAGCTCCCTTTCCAGG + Intergenic
982323855 4:154108944-154108966 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
982393601 4:154892156-154892178 CTCGCTTCAGCCCCCTTACCAGG - Intergenic
982548224 4:156761087-156761109 CTGTCTTCAGACTGCTCTTCAGG - Exonic
982725626 4:158902962-158902984 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
982733301 4:158979331-158979353 CTGGCTTCAGCCTCCTCTCCAGG + Intronic
982815410 4:159877884-159877906 CTGGCTTCAGCCCCATTTCCAGG + Intergenic
982909244 4:161118224-161118246 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
982915551 4:161204090-161204112 CTGGTTTCAGCCCCCTTTCCAGG - Intergenic
983041360 4:162931321-162931343 CTCCCTTCTGACCGCATTCCTGG - Intergenic
983047499 4:163004697-163004719 CAGGCTTCAGCCCCCTTTCCAGG + Intergenic
983167718 4:164497694-164497716 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
983179429 4:164630604-164630626 CTGGCTTTAGCCCCTTTTCCAGG - Intergenic
983299049 4:165902221-165902243 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
983331406 4:166333718-166333740 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
983485915 4:168331341-168331363 CTGGCCTCAGCCCCCTTTCCAGG + Intergenic
983543267 4:168935424-168935446 CTAGCTTGAGCCCCCTTTCCAGG - Intronic
983602769 4:169548946-169548968 CTGGCCTCAGCCCCCTTTCTAGG + Intronic
983840839 4:172455371-172455393 ATGGCTTCAGCCCCCTTTCCAGG - Intronic
983896243 4:173084790-173084812 CTGGCCTCAGCCCCCTTTCCAGG + Intergenic
983949471 4:173622531-173622553 CTAGCTTCAGCCCCCTTTCCAGG + Intergenic
983958825 4:173727925-173727947 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
984269850 4:177537088-177537110 CTGGCTTTAGCCCCCTTTTCAGG + Intergenic
984354182 4:178637144-178637166 CTGGCTTCAGCCCCGTTTCCAGG - Intergenic
984493657 4:180468587-180468609 CTGACTGCAGCCCCCTTTCCCGG - Intergenic
984526077 4:180860714-180860736 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
984902930 4:184600843-184600865 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
985317389 4:188672636-188672658 CTGGCTTCAGCCTCCTTTCCAGG - Intergenic
985353804 4:189096163-189096185 CTGTCTTCCGAGCACTTTCCCGG + Intergenic
985716240 5:1463521-1463543 CTGTCTTCAGCCCGAGTTCCAGG - Exonic
986006037 5:3669890-3669912 CTGGCTTTAGCCCCCTTTCCAGG + Intergenic
986110334 5:4709803-4709825 CTGGCTTCAGCCCTCTTCCCAGG - Intergenic
986378852 5:7162781-7162803 CTAGCTTCAGCTCCCTTTCCAGG + Intergenic
986511950 5:8517131-8517153 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
986581638 5:9272027-9272049 CAGGCTTCAGCCCCCTTTCCAGG - Intronic
986675169 5:10177853-10177875 CTGACTTCAGCCCCCTTTTCAGG - Intergenic
986879569 5:12153664-12153686 CTGTCTTCAGCCCCCTTTCCAGG - Intergenic
986920543 5:12674244-12674266 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
987019239 5:13852532-13852554 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
987656514 5:20814794-20814816 CTGGCTTCAGCCCCATTTCCAGG - Intergenic
987924101 5:24317946-24317968 CTAGCTTCAGCCCCCTTTCCAGG + Intergenic
988021435 5:25627107-25627129 ATGGCTTCAGCCACCTTTCCAGG - Intergenic
988167855 5:27617286-27617308 CTGGCTTCAGCCCCCTTTCTAGG + Intergenic
988289787 5:29270495-29270517 CTGGCTTCAACCCCATTTCCAGG - Intergenic
988402084 5:30775597-30775619 CTAGCTTTAGTCCCCTTTCCAGG - Intergenic
988618193 5:32795173-32795195 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
988628039 5:32898842-32898864 CTGGCTTCAGTCCTCTTTCCAGG + Intergenic
988719187 5:33859171-33859193 CTGGCTTTAGCCCCCTTTCCAGG - Intronic
988767042 5:34389151-34389173 CTGGCTTCAGCCCCATTTCCAGG + Intergenic
988774961 5:34469258-34469280 CTGGCTTCAGCCCCATTTCCAGG - Intergenic
988970766 5:36465397-36465419 CTGGCTTCACCCCTCTTTCCAGG - Intergenic
989363918 5:40634624-40634646 CTGGCTTCAACGCCCTTTCCAGG - Intergenic
989619066 5:43367209-43367231 CTGGCCTCAGCCCCCTTTCCAGG + Intergenic
989825316 5:45847964-45847986 CTGACTTCAGCCCACTTCCCAGG - Intergenic
989958858 5:50387198-50387220 CTGGCTTCAGCCCTCTTGCCAGG - Intergenic
990098839 5:52156805-52156827 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
990164353 5:52977887-52977909 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
990183788 5:53191312-53191334 CTGGCTTCAGCCCCGTTTGCAGG + Intergenic
990231342 5:53716145-53716167 CTGGCTTCAGCCTCCTATCCAGG - Intergenic
990673903 5:58162298-58162320 CTGGCTTCAGCCCCTTTTCCAGG + Intergenic
990745877 5:58959065-58959087 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
990803487 5:59631905-59631927 CTGGCTTCAGCCCCCTTCCAGGG - Intronic
990897598 5:60715788-60715810 TTGGCTTCAGACTGCTATGCTGG + Intergenic
991110762 5:62896813-62896835 CTGGCTTCAGCCCTCTTTCCAGG + Intergenic
991223553 5:64243252-64243274 CTGACTTCAGCCCCCTTTCCAGG - Intronic
991283256 5:64940094-64940116 CTGACTTCAGCCCCTTTTCCAGG + Intronic
992038898 5:72809006-72809028 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
992077841 5:73207231-73207253 CTGGCTTCAGCCCCCTTTTCAGG - Intergenic
992254900 5:74911744-74911766 CTGGCTTCTGCCCCCTTTCCAGG + Intergenic
992287264 5:75248307-75248329 CTGGCTTCAGCTCCCTTTCAAGG - Intergenic
992292449 5:75293221-75293243 CTGGTTTCAGCCCTCTTTCCAGG + Intergenic
992506099 5:77389049-77389071 CTGGCTTCAGTCTCCTTTCCAGG + Intronic
992740640 5:79770280-79770302 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
992908690 5:81373531-81373553 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
992976921 5:82130321-82130343 CTGGCTTTAGCCCCCTTTTCAGG + Intronic
992977722 5:82138203-82138225 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
993081132 5:83302186-83302208 CTGGCTTAAGCCCTTTTTCCAGG + Intronic
993255740 5:85588204-85588226 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
993265453 5:85721468-85721490 CTTGCTTCAGCCCCCTTTCCAGG - Intergenic
993402668 5:87472775-87472797 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
993410502 5:87567504-87567526 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
993455262 5:88120395-88120417 CTGGCTTCAGTTACCTTTCCAGG - Intergenic
993460188 5:88173108-88173130 CTGGCTTCAGCCCCCTTTTCAGG + Intergenic
993541608 5:89159342-89159364 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
993608999 5:90031672-90031694 CTTGCTTCAGCCCCTTTTCCAGG - Intergenic
993673936 5:90795161-90795183 CCGGCTTCAGCCCCCTCTCCAGG - Intronic
993757644 5:91751190-91751212 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
993894968 5:93523012-93523034 CTGGCTTTAGCCCCCTTTCCAGG - Intergenic
993911530 5:93690216-93690238 CTGGCTTCAGCCCCTTTTCCAGG - Intronic
994005180 5:94828918-94828940 TTGGCTTCAGCCCCCTTTCCAGG + Intronic
994015025 5:94955429-94955451 CTGGCTTTAGCCCCCTTACCAGG - Intronic
994137981 5:96309430-96309452 CTGGCTTCAGCCCTCTTTCCAGG + Intergenic
994142879 5:96361308-96361330 CTGGTTTCGGCCCCCTTTCCAGG + Intergenic
994233555 5:97336366-97336388 CTGGCGTCAGCCCCCTTTCCAGG + Intergenic
994378049 5:99037771-99037793 CTGGCTTCGGCTCCCTTTCCAGG - Intergenic
994438091 5:99763773-99763795 CTGACTTCAGCCCTTTTTCCAGG + Intergenic
994609502 5:102018729-102018751 CTGACTTCAGCGCCCTTTCCGGG - Intergenic
994918063 5:106004849-106004871 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
994991334 5:107000235-107000257 CTGGCTTCAGCCCTTTTTCCAGG + Intergenic
995108179 5:108398944-108398966 CTGGCTTCAGTCCCTTTTCAGGG - Intergenic
995301899 5:110594469-110594491 CTGGTTTCAGCCCCCTTTCCAGG - Intronic
995301914 5:110594573-110594595 CTGCCTTCAGACTGCTGTGCTGG - Intronic
995398725 5:111717167-111717189 CTGGCTTCAGACTCCTTTCCAGG + Intronic
995464401 5:112436148-112436170 CTGGCTTTAGCCCCCTTTCCAGG - Intergenic
995480340 5:112586499-112586521 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
995620594 5:114021413-114021435 CTTGCTTCAGCTCCCTTTCCAGG - Intergenic
995790675 5:115883181-115883203 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
995811163 5:116108664-116108686 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
996129920 5:119769691-119769713 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
996242493 5:121221080-121221102 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
996270757 5:121602215-121602237 CTGGCTTTAGGCCCCTTTCCAGG - Intergenic
996425970 5:123313657-123313679 CTGGATTCAGACCCCTTCCTTGG + Intergenic
996426640 5:123320305-123320327 CTGGCTTCAGCCCTTTTTCCAGG + Intergenic
996427938 5:123335324-123335346 CTGGCTTTAGCCCCCTTTCCAGG + Intergenic
996910904 5:128655950-128655972 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
996987517 5:129584875-129584897 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
997216624 5:132116923-132116945 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
997217866 5:132129396-132129418 CTGGCTTCAGCCCCCTTTCTAGG + Intergenic
997220393 5:132157418-132157440 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
997252265 5:132398289-132398311 CTGGCTTCAGCCCCCTTTCCGGG - Intergenic
997741585 5:136259546-136259568 CAAGCTTCTGACCGCTTTCTGGG + Intronic
997809554 5:136954021-136954043 CTGGCTTCAGCTCCCTTTCCAGG + Intergenic
998404922 5:141868879-141868901 CTGGCTTCAGACCGTGATGCTGG - Exonic
998644589 5:144048234-144048256 CTGGTTTCAGCACCCTTTCCAGG - Intergenic
998691643 5:144594718-144594740 CTGACTTCAGCCCCCTTTCCAGG + Intergenic
998752105 5:145333747-145333769 CTGGCTTCAGCCCCCTTTTAAGG + Intergenic
998780170 5:145647499-145647521 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
998927511 5:147142529-147142551 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
998934173 5:147216528-147216550 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
998972808 5:147611161-147611183 CTGGCTTCAGGCCCCTTTCCAGG + Intronic
998976951 5:147659019-147659041 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
999030094 5:148281261-148281283 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
999468648 5:151831312-151831334 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
999502402 5:152160285-152160307 CTGGTTTCAGCCCCCTTTCCAGG + Intergenic
999556789 5:152752115-152752137 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
999602572 5:153283062-153283084 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
999688299 5:154122318-154122340 CTGGCTTCAGTCCCCTTTCCAGG - Intronic
999983905 5:156984601-156984623 CTGGCTTCAGCCCCCTTCCCAGG - Intergenic
1000183206 5:158833079-158833101 CTCACCTCAGAACGCTTTCCTGG + Intronic
1000194793 5:158947164-158947186 CTGGCTTCAGCCTCCTTTCCAGG + Intronic
1000376140 5:160584006-160584028 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1000406464 5:160893210-160893232 ATGGCTTCAGCCCCCTTTTCAGG - Intergenic
1000548046 5:162625871-162625893 CTGACTTCAGCCCCCTTTCCTGG - Intergenic
1000820212 5:165973625-165973647 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1000860438 5:166450504-166450526 CTGGATTCAGCCCCCTTTCCAGG + Intergenic
1000996123 5:167960674-167960696 CTTGCTTCAGCCCCCTTTCCAGG + Intronic
1001362690 5:171103578-171103600 CTCACTTCAGCCCCCTTTCCAGG + Intronic
1002673512 5:180889862-180889884 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1002677146 5:180926485-180926507 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1002685759 5:181008185-181008207 CTAGCTTCAGCCCCCTTTCCAGG - Intergenic
1002734830 5:181377540-181377562 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1002749698 6:96580-96602 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1002944780 6:1750735-1750757 CTGGCTTCAGCCCTCTTTCCAGG - Intronic
1002996095 6:2286688-2286710 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1003713529 6:8619790-8619812 CTGGCTTCAGCCCCCTTTCTAGG + Intergenic
1003902554 6:10668479-10668501 CTGGATTCAGCCCCCTTCCCAGG + Intergenic
1004027971 6:11837351-11837373 CTGGTTTCAGCCCCCTTTCCAGG - Intergenic
1004076178 6:12346137-12346159 CTGCTTTCAGACCACTTGCCTGG + Intergenic
1004808981 6:19238857-19238879 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1004882842 6:20025742-20025764 GTGGCTTCAAACCCTTTTCCAGG + Intergenic
1004944493 6:20596640-20596662 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1005208565 6:23432797-23432819 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1005274165 6:24198670-24198692 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1005376310 6:25186011-25186033 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1005378256 6:25207396-25207418 CTGGCTTCAGCTGCCTTTCCAGG - Intergenic
1005778380 6:29162007-29162029 CTGGCTTCAGCCTCCTTTCCAGG + Intergenic
1005795743 6:29359937-29359959 TTGGCTTCAGCCCCCTTTCCAGG - Intronic
1006199940 6:32279379-32279401 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1007195623 6:40057258-40057280 CTGGCTTCAATCCCCTTTCCAGG + Intergenic
1007858115 6:44879088-44879110 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1008176226 6:48270999-48271021 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1008407620 6:51136417-51136439 CTGGCTTCAGCCTCCTTTTCAGG + Intergenic
1008425240 6:51349284-51349306 CTGGCTTCAGCTCCCTTTCTGGG + Intergenic
1008575490 6:52856530-52856552 CTGGCTTCAGGCCCCTTTCCAGG + Intronic
1008719123 6:54327617-54327639 CTGGCATCAGCCCACTTTCCAGG - Intronic
1008758427 6:54824986-54825008 CTGGCTTCAACCCCCTTTCCAGG + Intergenic
1008785092 6:55158468-55158490 CTGGCTTCAGCTCCCTTTCCAGG - Intronic
1008865404 6:56204147-56204169 CTGGTTTCCGCCCCCTTTCCAGG - Intronic
1008896860 6:56566173-56566195 ATGGCTTCAGCCCCCTTTCCAGG + Intronic
1009305922 6:62089198-62089220 CTGGCTTCAGTCCCCTTTCCAGG + Intronic
1009458742 6:63887820-63887842 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1009492692 6:64312042-64312064 CTGGTTTCAGGCCCCTTTGCAGG - Intronic
1009570161 6:65374565-65374587 CTGGCTTCAGCCCACTTTCCAGG - Intronic
1009727885 6:67558319-67558341 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1009777125 6:68218932-68218954 CTGGATTCAGCCCCCTTTCCAGG + Intergenic
1009797823 6:68494918-68494940 CTGGCTTCATCCTCCTTTCCAGG - Intergenic
1009880489 6:69560632-69560654 CTGGCTTCAGGTCCCTTTCCTGG - Intergenic
1009945382 6:70336603-70336625 CTGGCTTCATCCCCCTTTCCAGG + Intergenic
1009959533 6:70501471-70501493 CTGGCTTCAGCCTCCTTTGCAGG + Intronic
1010039171 6:71361298-71361320 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1010276318 6:73972268-73972290 CTGGCTTCAGCCCCTTTTCCAGG - Intergenic
1010447023 6:75959842-75959864 CTGGTTTCAGCCCCTTTTCCAGG + Intronic
1010459450 6:76097709-76097731 CTGGCTTCAACCCCCTTTCCAGG - Intergenic
1010574927 6:77518674-77518696 TTAGCTTCAGCCCCCTTTCCAGG - Intergenic
1010615350 6:78005789-78005811 CTGGCTTTAGCCCCCTTTCCAGG - Intergenic
1010668329 6:78655804-78655826 CTGGCTTCAACCCCTTTTCCAGG + Intergenic
1010681835 6:78807622-78807644 CTGACTTCAGCCCCCTTTCCAGG + Intergenic
1010701341 6:79051780-79051802 CTAGCATCAGACTGGTTTCCAGG - Intronic
1010822707 6:80433639-80433661 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1010936563 6:81869757-81869779 CTGGCTTCAGCCACCTTTCCAGG - Intergenic
1010993987 6:82512442-82512464 CTGGCTTCAGCCCCTTTTCCAGG - Intergenic
1011020699 6:82809366-82809388 TTGACTTCAGACTGCTTTGCTGG + Intergenic
1011020720 6:82809470-82809492 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1011120064 6:83942626-83942648 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1011137426 6:84115552-84115574 CTGGCTTCAGCCCCCTTTCTAGG + Intergenic
1011139246 6:84134335-84134357 CTGGCTTCAACCCTCTTTCCAGG + Intronic
1011174080 6:84540984-84541006 CTGGCTTCAACCCCCTTTCCAGG - Intergenic
1011235598 6:85213136-85213158 CTGGCTTCAGCCTCCTTTCCAGG + Intergenic
1011298951 6:85853871-85853893 CTGGCTTCAGCCTCCTTTGCAGG + Intergenic
1011301466 6:85878885-85878907 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1011318710 6:86065764-86065786 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1011332771 6:86228343-86228365 CTGGCTTCAGCTCCCTTTCCAGG + Intergenic
1011333644 6:86236678-86236700 CTAGCTTCAGCCCCCTTTCCAGG - Intergenic
1011387702 6:86815609-86815631 CTGGCTTCATCCCCCTTTCCAGG + Intergenic
1011578167 6:88827554-88827576 CTGGCTTCAGCCGCCTTTCCAGG - Intronic
1011766247 6:90623274-90623296 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1011776805 6:90739716-90739738 CTGGCTTCAGCCCCCTTTCTAGG + Intergenic
1011831262 6:91374687-91374709 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1012043389 6:94238845-94238867 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1012043408 6:94238949-94238971 TTGACTTCAGACTGCTTTGCTGG - Intergenic
1012083093 6:94785417-94785439 CTGGCCTCTGTCCCCTTTCCAGG + Intergenic
1012207489 6:96478873-96478895 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1012343496 6:98157130-98157152 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1012597141 6:101054126-101054148 CTGGCTTCAGTCCTCTTTCCAGG + Intergenic
1012644422 6:101661452-101661474 CTGACTTCAGCCCCCTTGCCAGG + Intronic
1012674740 6:102100916-102100938 CTGGCTTCAGCCCTCTTTCCAGG - Intergenic
1012777971 6:103522034-103522056 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1012922440 6:105233981-105234003 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1013025018 6:106263007-106263029 GTGGCTTCAGCACCCTTTCCAGG - Intronic
1013037971 6:106405046-106405068 CTGGTTTCAGTCCCCTTTCCAGG - Intergenic
1013390216 6:109679119-109679141 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1013452973 6:110303327-110303349 CTGGCTTCAGCCCCTTTTCCAGG - Intronic
1013625689 6:111934942-111934964 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1013672602 6:112421544-112421566 CTTACTTCAGCCCTCTTTCCAGG - Intergenic
1013682580 6:112541495-112541517 CTGACTTCAGCCCCCTTTCCAGG - Intergenic
1013920169 6:115394574-115394596 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1013929710 6:115516282-115516304 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1013956894 6:115852464-115852486 CTCACTTCAGTCCCCTTTCCAGG - Intergenic
1013964190 6:115935511-115935533 CTGGCTTCAGCCCCCCTTCCAGG - Exonic
1014058507 6:117044066-117044088 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1014113364 6:117645783-117645805 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1014122857 6:117746189-117746211 CTGGCTTTAGCCCTCTTTCCAGG - Intergenic
1014223563 6:118823084-118823106 CTGCCATCAGCCCCCTTTCCAGG + Intronic
1014278820 6:119418105-119418127 CTGGCTTCAGCCCCCTTTCCGGG - Intergenic
1014387085 6:120816171-120816193 CTGGCCTCAGCCCCCTTTCCAGG + Intergenic
1014413439 6:121153969-121153991 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1014527842 6:122522359-122522381 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1014584585 6:123182602-123182624 CTAGCTTCAGCCCCCTTTCCTGG - Intergenic
1014753679 6:125280401-125280423 CTGGCTTCAGCCCCCTTTCTAGG - Intronic
1014836572 6:126167092-126167114 CTGACTTCAGCCCCCTTTCCAGG + Intergenic
1014872649 6:126615023-126615045 CTGGCTTCAGCCCACTTACCAGG + Intergenic
1014968181 6:127782275-127782297 CTGGCTTCAGCCCTCATTCCAGG + Intronic
1014971664 6:127824049-127824071 CTGGCTTCACCTTGCTTTCCAGG - Intronic
1015108893 6:129569142-129569164 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1015163041 6:130174154-130174176 CTGGCTTCAGCCTCTTTTCCAGG + Intronic
1015211297 6:130701782-130701804 CTGGTTTCAGCCCCCTTTCCAGG - Intergenic
1015291054 6:131538725-131538747 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1015433239 6:133155042-133155064 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1015471853 6:133614774-133614796 CTGGATTCAGCCCCCTTTCCAGG - Intergenic
1015500745 6:133930849-133930871 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1015623420 6:135156313-135156335 CTGGCTTCAGCCCCCTTTCCTGG + Intergenic
1015802055 6:137070296-137070318 GTGGCTTAAGCCCCCTTTCCAGG - Intergenic
1016186113 6:141199161-141199183 CTGGCTTTAGGCTGCTGTCCTGG + Intergenic
1016241851 6:141940259-141940281 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1016483512 6:144508215-144508237 CTGGCTTCAGTCCCCTTTCCAGG + Intronic
1016542148 6:145178111-145178133 CTGGCTTCAGCCCCTTTTCCAGG - Intergenic
1016590862 6:145742081-145742103 CTGGCTTCAACCCCCTTTCCAGG - Intergenic
1016638728 6:146324370-146324392 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1016691560 6:146943587-146943609 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1016717533 6:147251453-147251475 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1017197428 6:151716808-151716830 CTGGCTTCAGCCCCCTTTTCTGG + Intronic
1017322605 6:153111105-153111127 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1017571391 6:155748755-155748777 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1017968726 6:159290512-159290534 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1018094543 6:160373985-160374007 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1018108692 6:160513851-160513873 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1018797663 6:167199853-167199875 CTGGCTTTAGCCCCCTTTGCAGG + Intergenic
1018805772 6:167258443-167258465 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1019003476 6:168776514-168776536 CTGGCCTGAAATCGCTTTCCTGG - Intergenic
1019203694 6:170341473-170341495 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1019239091 6:170649860-170649882 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1020333388 7:7042299-7042321 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1020339003 7:7089251-7089273 CTGGCTTCAGCCCTTTTTCCAGG + Intergenic
1020367251 7:7393906-7393928 CTGGCTTTAGCCCCCTTTCCAGG + Intronic
1020391432 7:7662287-7662309 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1020608617 7:10367714-10367736 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1020629727 7:10625530-10625552 CTGGCTTCAGCTCCCTTTCCAGG - Intergenic
1020693838 7:11391570-11391592 CTGGCCTCAGCCCCCTTTCCAGG + Intronic
1020694025 7:11392545-11392567 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1020716038 7:11675427-11675449 CTGGCTTCAGCCCTCTTTCCAGG - Intronic
1020823866 7:13002940-13002962 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1020884335 7:13803570-13803592 TTGGCCTCAGCCCCCTTTCCAGG - Intergenic
1020935471 7:14458865-14458887 CTGGCTTCAGCTCCCTTTCCAGG - Intronic
1021014640 7:15517834-15517856 CTGGCTTCAGCTCCCTTTCCAGG - Intronic
1021167035 7:17354421-17354443 CTGGCTTCAGCCTCCTTTCCAGG + Intergenic
1021207834 7:17807118-17807140 CTGGCTTCAGCCCTCTTTCCAGG - Intronic
1021322293 7:19227064-19227086 CTGGCTTCAGCCCCCTTTTCAGG - Intergenic
1021502344 7:21345282-21345304 CGGGCTTCAGCCCCCTTTCCAGG + Intergenic
1021749373 7:23779814-23779836 CTGGCTTCAACCCTCTTTTCAGG + Intronic
1022058871 7:26770432-26770454 CTGGCTTCAGTCCCTTTTCCAGG + Intronic
1022615609 7:31926974-31926996 CTAGCTTCAACCCCCTTTCCAGG - Intronic
1022848481 7:34235613-34235635 CTAGCTTCATCCCCCTTTCCAGG + Intergenic
1022869091 7:34457379-34457401 CTGGCTTTAGCCCCTTTTCCAGG - Intergenic
1023103332 7:36740514-36740536 CTGCCTTCAGACCTCATCCCTGG + Intergenic
1023339203 7:39201607-39201629 CAGACTTCAGAGAGCTTTCCTGG + Intronic
1023511646 7:40959643-40959665 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1023697788 7:42865407-42865429 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1023894288 7:44419097-44419119 CTGGCTTCAGCCTCCTTTCCAGG - Intronic
1024017698 7:45332995-45333017 GTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1024255864 7:47539607-47539629 CTGGCTGAAAACCGCTGTCCTGG + Intronic
1024495425 7:50040820-50040842 CTGGTTTCAGCCCCCTTTCCAGG - Intronic
1024664926 7:51536740-51536762 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1024950531 7:54856004-54856026 CTGGCTTCAGCTCACTTTCCAGG + Intergenic
1024998548 7:55294891-55294913 CTGACTTCAGCCCCCTTTCTAGG + Intergenic
1025637954 7:63340104-63340126 CTGGATTCAGTCCTCTTTCCAGG + Intergenic
1025644742 7:63407995-63408017 CTGGATTCAGTCCTCTTTCCAGG - Intergenic
1025714376 7:63941411-63941433 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1027267674 7:76503263-76503285 CTGGCTTCCAACAGCTTCCCTGG - Intronic
1027319486 7:77003126-77003148 CTGGCTTCCAACAGCTTCCCTGG - Intergenic
1027582859 7:80020288-80020310 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1027778245 7:82492704-82492726 CTGGCTTCAGCCCCCTTTCCCGG + Intergenic
1027843335 7:83341787-83341809 CAGGCTTCAGCCCCCTTTCCAGG - Intergenic
1028142390 7:87288386-87288408 CTGGCTCCAGCCCCCTTTCCAGG + Intergenic
1028144274 7:87304519-87304541 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1028145899 7:87319493-87319515 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1028295841 7:89130314-89130336 CTGGCTTCCTACTCCTTTCCTGG - Intronic
1028327001 7:89540123-89540145 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1028429981 7:90735802-90735824 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1028476352 7:91257853-91257875 CTGGCTTCAGCCCCCTTTCTAGG + Intergenic
1028627984 7:92898692-92898714 CTGGCTTCATCCCTTTTTCCAGG + Intergenic
1028648183 7:93121039-93121061 CTGGCTTCAGCCCCCTTTTCAGG - Intergenic
1028652867 7:93170388-93170410 CTGGCTTCAGCCCTCTTTCTAGG + Intergenic
1028801428 7:94970125-94970147 CTGCCTTCAGCCCCCTTTCCAGG + Intronic
1028991231 7:97051072-97051094 CTGGATTCAGCCCCCTTTACAGG - Intergenic
1028998385 7:97126773-97126795 CTGGCTTCAGCTCCCTTTCCAGG + Intronic
1029324782 7:99796701-99796723 CTGGTTTCAGCCCCCTTTCCAGG + Intergenic
1029458294 7:100681951-100681973 CTCGCTGCAGACGGCCTTCCAGG - Exonic
1029816954 7:103106413-103106435 ATGGCTTCAGCCCCCTTTCCAGG - Intronic
1029851131 7:103462723-103462745 CTGGCTTCAGCTCCCTTTCCAGG + Intergenic
1030141053 7:106304444-106304466 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1030159521 7:106493035-106493057 CTAGCTTCAGCCCCCTTTCCAGG - Intergenic
1030325867 7:108217896-108217918 CTGGCTTCAGCTCCCTTTCCAGG + Intronic
1030482285 7:110119854-110119876 CTGGCTTCAGCCACCTTTCCAGG - Intergenic
1030500837 7:110356760-110356782 CTGACTTCAGCCCCCTTTCCAGG + Intergenic
1030534013 7:110743923-110743945 CTGGCTTCAGCCCCCTTTGCAGG - Intronic
1030612655 7:111706180-111706202 CGGGCTTCAGCACCCTTTCCAGG + Intergenic
1030703099 7:112662539-112662561 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1030705652 7:112690141-112690163 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1030771126 7:113475887-113475909 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1030801319 7:113856432-113856454 CTGGCTTCAGCCCCCTTTACAGG - Intergenic
1030958832 7:115889312-115889334 CTGGCTTCAGCCCCCTTTCCGGG - Intergenic
1031031818 7:116743390-116743412 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1031710983 7:125046464-125046486 CTGGCTTCAGCCCCTTTTCCAGG - Intergenic
1031717312 7:125125195-125125217 CTGGCTTCAGCCCTTTTTCCAGG + Intergenic
1032367691 7:131315561-131315583 CTGGCTTCAGCCTCCTTTCCAGG - Intronic
1032659774 7:133970322-133970344 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1032883538 7:136115106-136115128 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1032893291 7:136222637-136222659 CTGGCTTTAACCCCCTTTCCAGG - Intergenic
1032957139 7:136984417-136984439 CTGGCTTCAGCCCCCATTCCAGG + Intronic
1032966429 7:137103552-137103574 CTGGCTTCAGCCCTCTTTCCAGG - Intergenic
1033617640 7:143032177-143032199 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1033680026 7:143584559-143584581 CTGGCTTCAGCTCCCTTTCCAGG - Intergenic
1033691808 7:143744883-143744905 CTGGCTTCAGCTCCCTTTCCAGG + Intergenic
1034314467 7:150117245-150117267 CTGGCCTCAGCCTCCTTTCCAGG - Intergenic
1034370797 7:150594720-150594742 CTGGCTTCAGCCCCCTTTCTAGG + Intergenic
1034792429 7:153983524-153983546 CTGGCCTCAGCCTCCTTTCCAGG + Intronic
1035508681 8:156749-156771 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1035710728 8:1712039-1712061 CTGGCTGCAGCCCCTTTTCCAGG - Intergenic
1035794044 8:2337075-2337097 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1035798761 8:2384633-2384655 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1035998337 8:4574100-4574122 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1036553755 8:9838830-9838852 CTGGCTTCAGCCCTCTTTTCAGG - Intergenic
1037090174 8:14905380-14905402 ATGACATCACACCGCTTTCCAGG + Intronic
1037258305 8:16979795-16979817 CTGGCCTCAGCCCCCGTTCCAGG + Intergenic
1037285497 8:17294430-17294452 CTGGCATCAGCCCCCTTTCCAGG + Intronic
1037664506 8:20956452-20956474 CTGGCTTCAGCACCCTTTCCAGG - Intergenic
1037719628 8:21431517-21431539 CTGGCTTTGGGCCCCTTTCCAGG - Intergenic
1038169003 8:25111565-25111587 CTGGCTTTAGCTTGCTTTCCTGG + Intergenic
1038211554 8:25523204-25523226 CTGGCTTCAGCGCTCTTTCCAGG - Intergenic
1038936469 8:32257262-32257284 CTGACTCCAGCCCCCTTTCCAGG + Intronic
1038993772 8:32898991-32899013 CTGGCTTCAGACCATGATCCTGG + Intergenic
1039133833 8:34297736-34297758 CTGTCTTCAGCTCCCTTTCCAGG - Intergenic
1039284538 8:36026539-36026561 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1039754852 8:40512416-40512438 CTGGCTTCAGCCTCCTTTCCAGG + Intergenic
1040473876 8:47760101-47760123 CTGGCTTCAGCCCCCTTTCTAGG + Intergenic
1040520117 8:48169345-48169367 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1040736537 8:50515465-50515487 TTGGCTTCAGCCCCCTTTCCAGG - Intronic
1040779875 8:51095135-51095157 CTGGCTTCAGCCCACTTTCTAGG - Intergenic
1040943069 8:52852636-52852658 CTGGCTTCAGCCCCCCTTCAGGG + Intergenic
1040968828 8:53112461-53112483 CTGCCTTCAGCCCCCTTTCCAGG + Intergenic
1041050791 8:53932291-53932313 CTGGCTTCAGCCCCCTTTTCAGG - Intronic
1041287279 8:56273682-56273704 CTGGCTTCAGCACCCTTTCCAGG - Intergenic
1041304783 8:56447421-56447443 CTGCCTTGAGAGCGCTGTCCAGG + Intergenic
1041323326 8:56637294-56637316 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1041459764 8:58098521-58098543 CTGGCTTCAGCCCCGTTTCCAGG + Intronic
1041583979 8:59495066-59495088 CTGGCTTCAGCTCCCTTTTCAGG + Intergenic
1041630593 8:60082912-60082934 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1041838356 8:62242214-62242236 CTGGCTTCAGCCCCCTTTTCTGG + Intergenic
1041900651 8:62978693-62978715 CTGGTTTCAGCCCCCTTTCCAGG + Exonic
1042110904 8:65380099-65380121 CTGGCTTCAGCCCCCTATCCAGG - Intergenic
1042327188 8:67540981-67541003 CTGGCTTCAGCCCTCTTTCTGGG + Intronic
1042349322 8:67761280-67761302 CTGGCTTTAGCCCCCTTTCCAGG - Intergenic
1042478793 8:69280361-69280383 CTGGCTTCAGCCTCCTTTCCAGG - Intergenic
1042622737 8:70724359-70724381 CTGGCTTCAGTTCCCTTTCCAGG + Intronic
1042753478 8:72184380-72184402 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1042946166 8:74156667-74156689 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1042969327 8:74391156-74391178 CTGACTTCAGCCCGCTTTACAGG + Intronic
1043036675 8:75208196-75208218 CTGACTTCAGACTGCTGTGCTGG + Intergenic
1043036694 8:75208300-75208322 CTGGCTTTAGCCCCCTTTCCAGG + Intergenic
1043118171 8:76286531-76286553 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1043253686 8:78106570-78106592 CTGGCTTCAGCCCCCTCTCCAGG + Intergenic
1043366338 8:79537417-79537439 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1043511314 8:80952835-80952857 CTGGCTTCAGCCCCCTTTCAAGG - Intergenic
1044131072 8:88525346-88525368 CTGGTTTCAGCTCCCTTTCCAGG - Intergenic
1044267706 8:90203341-90203363 CTGGCTTCAGCGCCCTTTCCAGG - Intergenic
1044312395 8:90709013-90709035 CTGGCTTCAGCCCTCTTTCTAGG + Intronic
1044503542 8:92990915-92990937 CTGGCTTCAGCCCCCTTTTCAGG - Intronic
1044509495 8:93058441-93058463 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1044595281 8:93953247-93953269 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1044940278 8:97335117-97335139 CTGGTTTCATTCCCCTTTCCAGG + Intergenic
1044960996 8:97530322-97530344 CTGGCTTCAATCCCCTTTCCAGG - Intergenic
1045151791 8:99416291-99416313 TTGACTTCAGACTGCTGTCCTGG + Intronic
1045151808 8:99416395-99416417 CTGACTTCAGTCCCCTTTCCAGG + Intronic
1045185202 8:99830577-99830599 ATGGCTTAAGCCCCCTTTCCAGG + Intronic
1045199649 8:99967394-99967416 ATGGCTTCAGCCCCCTTTCCAGG - Intronic
1045390560 8:101710427-101710449 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1045618883 8:103951765-103951787 CTGGCTTCAGCCCACTTTCCAGG - Intronic
1045783660 8:105897136-105897158 CTGGCTTCTGCCCCCTTTCCAGG - Intergenic
1045973317 8:108103946-108103968 CTGGCTTCAGCCCTCTTTCCAGG - Intergenic
1046014607 8:108590224-108590246 CTGGCTTCAGCCGCCTTTCCAGG - Intergenic
1046047994 8:108986536-108986558 CTGGCTTCAGCCTCCTTTCCAGG + Intergenic
1046068007 8:109218987-109219009 CTGGCTTCAGCCCCCTTCCCAGG + Intergenic
1046106477 8:109672694-109672716 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1046153500 8:110257856-110257878 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1046165897 8:110434990-110435012 CTAGCTTCAGACCTCTTTGAGGG - Intergenic
1046277790 8:111985740-111985762 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1046295845 8:112218288-112218310 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1046947492 8:119987995-119988017 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1046972562 8:120238585-120238607 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1047121280 8:121908083-121908105 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1047133661 8:122051534-122051556 CTGGCTTTAGCCCCCTTTCCAGG - Intergenic
1047369600 8:124245528-124245550 CTCGCTTCAGCCCCCTTTCCAGG + Intergenic
1048630123 8:136233641-136233663 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1048914145 8:139165651-139165673 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1048933361 8:139335303-139335325 CCGGCTTCAGAGCACTTTCCTGG - Intergenic
1048997010 8:139800704-139800726 GTGGTTTCAGACAGCTCTCCTGG - Intronic
1049872391 8:144990790-144990812 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1049964582 9:766908-766930 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1050031743 9:1393539-1393561 CTGGCTTCAGCCCCGTTTCCAGG - Intergenic
1050141568 9:2521483-2521505 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1050201361 9:3148987-3149009 CTGGCTTCGGCCCCCTTTCCAGG + Intergenic
1050234413 9:3562859-3562881 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1050300524 9:4253585-4253607 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1050369050 9:4902062-4902084 CTGGCTTCAGCCCTCTTTCCAGG + Intergenic
1050391926 9:5153204-5153226 CTGGCTTCAGCCCCCTTTTCAGG - Intronic
1050450818 9:5779660-5779682 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1050750637 9:8932848-8932870 CTGGCTTCCGTCGCCTTTCCAGG + Intronic
1050852037 9:10300424-10300446 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1050963314 9:11765725-11765747 TTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1050973933 9:11912388-11912410 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1051199413 9:14599616-14599638 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1051321965 9:15914624-15914646 CTGGCTTCAGGCCCCTTTCCAGG + Intronic
1051548706 9:18305369-18305391 CTGGCTTCAGCCCCCTTTCTAGG - Intergenic
1051695832 9:19767271-19767293 CTGGCTTCAGCCCCCTTTTCAGG + Intronic
1051814298 9:21087386-21087408 CTGGCTTCAGCCCCCTTTACAGG - Intergenic
1051863406 9:21651828-21651850 GTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1051940243 9:22496427-22496449 CTGGCTTTGGCCCCCTTTCCAGG + Intergenic
1051982886 9:23045860-23045882 CTGGCTTTAGCCTCCTTTCCAGG - Intergenic
1051998446 9:23247894-23247916 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1052096612 9:24391458-24391480 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1052125147 9:24765376-24765398 CTGGCTTCAGCCCCCTGTCCAGG + Intergenic
1052134065 9:24888939-24888961 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1052146920 9:25061287-25061309 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1052326473 9:27220943-27220965 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1052329360 9:27251659-27251681 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1052336415 9:27324590-27324612 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1052382353 9:27785162-27785184 CTGGCTTCAGCTCTGTTTCCAGG + Intergenic
1052506341 9:29359104-29359126 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1052752724 9:32508763-32508785 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1053608181 9:39681368-39681390 CTGGTTTCAGCCCCCTTTCCAGG + Intergenic
1053866022 9:42437728-42437750 CTGGTTTCAGCCCCCTTTCCAGG + Intergenic
1054245350 9:62661041-62661063 CTGGTTTCAGCCCCCTTTCCAGG - Intergenic
1054559478 9:66695572-66695594 CTGGTTTCAGCCCCCTTTCCAGG - Intergenic
1054719901 9:68594124-68594146 CTGGCTTCAGCCCCATCTCCAGG + Intergenic
1054884937 9:70185857-70185879 CTGGCTTCAGCTCCCTTTCCAGG + Intronic
1054889105 9:70232660-70232682 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1054892537 9:70267628-70267650 CTGGGTTCAGATCGTTTTTCTGG + Intronic
1055125735 9:72716740-72716762 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1055210296 9:73783197-73783219 CTGGCTTCAGCTCCCTTTCCAGG - Intergenic
1055239207 9:74163658-74163680 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1055338996 9:75261930-75261952 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1055345067 9:75327124-75327146 CTGGCTTCAGCAACCTTTCCAGG + Intergenic
1055386848 9:75771854-75771876 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1055494559 9:76841480-76841502 TTGGCTTCAGCCCCCTTTCCAGG - Intronic
1055571753 9:77623931-77623953 CTGGCTTCAGCCCCTTTTCCAGG - Intronic
1055628739 9:78201111-78201133 CTGGCTTTAGCCCCCTTTCCAGG - Intergenic
1056002115 9:82228218-82228240 CTGGGTTCAGCCCGATTTCTAGG + Intergenic
1056003551 9:82242979-82243001 CTGGCTTCAGCCTCCTTTTCAGG + Intergenic
1056123717 9:83514125-83514147 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1056320889 9:85433555-85433577 CTGGCTTCAGCCACCTTTCCAGG - Intergenic
1056385164 9:86090715-86090737 CTGGCTTCAGCCTCCTTTCCAGG + Intronic
1056997798 9:91479623-91479645 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1058029253 9:100177288-100177310 CTGACTTCAGCCCCCTTTCCAGG - Intronic
1058072898 9:100619588-100619610 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1058265776 9:102897585-102897607 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1058393163 9:104520333-104520355 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1058408446 9:104703623-104703645 CTGGCTTTAGACCCCTTTCTAGG - Intergenic
1058905025 9:109475853-109475875 CTGGCTTCAGACTCCTTGGCGGG - Intronic
1059076277 9:111197019-111197041 CTGGATTCAGCCCCCTTTCTAGG - Intergenic
1059088829 9:111334462-111334484 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1059513330 9:114869869-114869891 CTGGCTTCAGCCCCCTTTGCAGG - Intergenic
1061851953 9:133421561-133421583 CTGGCTTGGGGCTGCTTTCCTGG + Intronic
1062297586 9:135841011-135841033 CTGACTTCAGCACCCTTTCCAGG - Intronic
1062759296 9:138330150-138330172 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1203599746 Un_KI270748v1:923-945 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1186370037 X:8937369-8937391 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1186599824 X:11024773-11024795 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1186832485 X:13404432-13404454 CTGGCTTCAGCCCACTTTCCAGG - Intergenic
1186833426 X:13413972-13413994 CTGGATTCAGACCCCCTTTCCGG - Intergenic
1187660828 X:21545049-21545071 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1187704138 X:21992925-21992947 CTGGCTTGCCACAGCTTTCCAGG + Intronic
1187839960 X:23476876-23476898 CTGGCTTCAGCACCCTTTCCAGG + Intergenic
1188130037 X:26419742-26419764 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1188193192 X:27197148-27197170 CTGGCTTCAGCCTTCTTTCCAGG - Intergenic
1188201670 X:27299684-27299706 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1188561263 X:31471128-31471150 CTGACTTCAGTCCCCTTTCCAGG + Intronic
1188664618 X:32804139-32804161 CTGGTTTCAGCCCCCTTTCCAGG - Intronic
1188893311 X:35636340-35636362 CTGGTTTCAGCCCCCTTTCCAGG + Intergenic
1189039782 X:37530435-37530457 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1189171516 X:38914037-38914059 CTGGTTTCCTACCACTTTCCTGG - Intergenic
1189189616 X:39088968-39088990 CTGGCTTCAGCCCCCTTTTCAGG - Intergenic
1189210827 X:39280681-39280703 CTGACTTCAGCCCCCTTTCCAGG + Intergenic
1189236215 X:39489338-39489360 CTGGCTTAAGAGCTCTGTCCTGG - Intergenic
1189575128 X:42343348-42343370 CTGGTTTCAGCCCCCTTTCCAGG + Intergenic
1189652358 X:43203848-43203870 CTGGATTCAGCCCCCTTTCTAGG + Intergenic
1189713575 X:43840961-43840983 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1189937741 X:46087283-46087305 CTGGCTTCAACCCCCTTTCCAGG - Intergenic
1190495107 X:51021043-51021065 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1190505855 X:51125389-51125411 CTGGTTTCAGCCCCCTTTCCAGG - Intergenic
1190943994 X:55073044-55073066 CCGGATTCAGCCCCCTTTCCAGG + Intergenic
1190959783 X:55234798-55234820 CTAGCTTCAGCCCCCTTTCTAGG + Intronic
1190963748 X:55278072-55278094 CTGGCTTCAGACCCCTTTCCAGG + Intronic
1190966436 X:55305696-55305718 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1190995707 X:55606470-55606492 CTGGCTTCAAACCCCTTTCCAGG + Intergenic
1191005057 X:55702585-55702607 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1191024255 X:55896556-55896578 CTGGCTTCAGCCCCCTTTTCAGG - Intergenic
1191078899 X:56487826-56487848 CTGGATTCAGCCCTCTTTCCAGG + Intergenic
1191088734 X:56597643-56597665 TTGGCTTCAGTCCTTTTTCCAGG + Intergenic
1191094369 X:56659129-56659151 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1191097450 X:56688589-56688611 CTGGCTTCAGACCCCTTTCCAGG + Intergenic
1191098995 X:56704909-56704931 CTGGCTTCAGCTTCCTTTCCAGG + Intergenic
1191113969 X:56832616-56832638 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1191119728 X:56890785-56890807 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1191133311 X:57038011-57038033 CTGGCTTCAGCCTCCTTTCCAGG + Intergenic
1191148126 X:57190374-57190396 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1191153233 X:57242921-57242943 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1191168553 X:57418206-57418228 CTGGCTTCAGCCCTTTTTCCAGG + Intronic
1191174186 X:57482215-57482237 CTGGCTTCAGACCCCTTTCCAGG + Intronic
1191186662 X:57620654-57620676 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1191206697 X:57842245-57842267 TTGTCTTCAGCCCCCTTTCCAGG - Intergenic
1191222330 X:58002908-58002930 CTGACATCAGCCCCCTTTCCAGG - Intergenic
1191591310 X:62888260-62888282 CTGGCTTCAGCCCCCTTTATGGG - Intergenic
1191606230 X:63065806-63065828 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1191631931 X:63331189-63331211 CTGTCTTCAGTCCCCTTTCCAGG - Intergenic
1191676616 X:63797942-63797964 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1191686721 X:63899610-63899632 CTGGTTTCAGCCCCCTTTGCAGG - Intergenic
1191705100 X:64085850-64085872 CTGGCTTCAGCCCCCTTTTCAGG - Intergenic
1191793758 X:64999604-64999626 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1191795635 X:65018697-65018719 CTAGCTTCAGCCCCCTTTCCAGG - Intronic
1191809982 X:65176052-65176074 CTGGCTTCAGCCTCCTTTCCAGG - Intergenic
1191809998 X:65176156-65176178 TTGACTTCAGACTGCTGTCCTGG - Intergenic
1191824828 X:65353626-65353648 CTGGCTTCAGACCCCTTTCCAGG - Intergenic
1191848616 X:65569298-65569320 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1191872955 X:65765357-65765379 CTGGCCTCAGCCTCCTTTCCAGG + Intergenic
1191908971 X:66127198-66127220 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1191928702 X:66344537-66344559 TTGGCTTCAGACTGCTGTGCTGG + Intergenic
1191931371 X:66376596-66376618 CTGGCTTCAGCCCCGCTTCCAGG + Intergenic
1191947734 X:66553958-66553980 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1191962468 X:66718764-66718786 CTGGCTTCAGACCCTTTACTAGG - Intergenic
1191969650 X:66799194-66799216 CTGGCTTCAACCCTCTTTCCAGG - Intergenic
1191984817 X:66968639-66968661 CTGGCTTCAGCCCCCTTCCTAGG - Intergenic
1192018441 X:67357895-67357917 CTGGCTTCAGCCTTCTTTCCAGG - Intergenic
1192064294 X:67864714-67864736 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1192128998 X:68530443-68530465 CTGGCTTCAGCTCCCTTTCCAGG + Intronic
1192228441 X:69246071-69246093 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1192524531 X:71830128-71830150 CTGGCTTTAGCCCCCTTTCCAGG - Intergenic
1192598534 X:72437504-72437526 CTGACTTCAGCCCCCTTTTCAGG - Intronic
1192662117 X:73052535-73052557 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1192674573 X:73182548-73182570 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1192701803 X:73482302-73482324 CTGGTTTCAGACCCCTTTCCAGG + Intergenic
1192707395 X:73541051-73541073 CTGGCTTCAGTCCCCTTTTCAGG - Intergenic
1192707404 X:73541155-73541177 TTGGCTTCAGACTGCTATGCTGG - Intergenic
1192712633 X:73607459-73607481 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1192741006 X:73892694-73892716 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1192755836 X:74046496-74046518 CTGGCTTCAGCCCCCTTTCTAGG + Intergenic
1192759210 X:74078029-74078051 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1192878565 X:75258285-75258307 CTGGCTTCAGCCCTCTTTCCAGG - Intergenic
1192884290 X:75320529-75320551 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1192916074 X:75652451-75652473 CTGGCTTCAGCCTCCTTTCCAGG + Intergenic
1192931783 X:75814361-75814383 CCGGCTCCAGCCCCCTTTCCAGG - Intergenic
1192933981 X:75839238-75839260 CTGGCTTCAGTTTCCTTTCCAGG + Intergenic
1192953195 X:76039592-76039614 CTGGTTTCAGCCCGTTTTCCAGG + Intergenic
1192958193 X:76095823-76095845 CTGGCTTCAGCCCCCTTTCGAGG + Intergenic
1192964144 X:76159474-76159496 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1192966570 X:76183256-76183278 CTGGCTTCAGCCTCCTTTCCAGG + Intergenic
1192971285 X:76233808-76233830 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1192977680 X:76303397-76303419 CTGGGTTCAGCCTTCTTTCCAGG + Intergenic
1192994001 X:76492835-76492857 CTGGCTTCAGTACCCTTTCCAGG - Intergenic
1192998047 X:76533395-76533417 CTGGCTTCAGCCCGCTTTACAGG + Intergenic
1192999632 X:76550422-76550444 CTGGCTTCAGCCCCCTTTCTAGG + Intergenic
1193010616 X:76671196-76671218 CTGGCTTCAGCTCCCTTTCCAGG - Intergenic
1193034456 X:76934389-76934411 CTGGCTTCAGCTCCCTTTCCAGG - Intergenic
1193040480 X:76998956-76998978 CTGGTTTCAGCCCCCTTTCCAGG + Intergenic
1193065412 X:77254209-77254231 CTGGCTTCAGCCCCTTTTCCAGG - Intergenic
1193071870 X:77314832-77314854 CTGGCTTCAGCCCCCTTTCCCGG - Intergenic
1193079325 X:77390367-77390389 CTGGCTTCAGCCCCTTTTTCGGG - Intergenic
1193081605 X:77412017-77412039 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1193113785 X:77756324-77756346 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1193228446 X:79013407-79013429 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1193266829 X:79482176-79482198 CTGGCTTCAGCCTCCTTTCTAGG - Intergenic
1193284643 X:79697262-79697284 CTGGCTTCTGTCCCCTTTCCAGG + Intergenic
1193341328 X:80352637-80352659 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1193350827 X:80462645-80462667 CTAGCTTCAGCCCCCTTTCCAGG - Intergenic
1193356014 X:80521173-80521195 CTGGTTTCAGTCCCCTTTCCAGG + Intergenic
1193361702 X:80586748-80586770 TTGACTTCAGACCGCTGTGCTGG + Intergenic
1193382194 X:80828164-80828186 CTGGCTTCAGCCCCATTTCCAGG + Intergenic
1193389152 X:80906267-80906289 CTGGCTTTAGCCCCCTTTCCAGG - Intergenic
1193394455 X:80967766-80967788 CTGCCTTCAGTCCCCTTTCCAGG - Intergenic
1193398118 X:81010216-81010238 CTAGCTTCAGCCCCCTTTCCAGG + Intergenic
1193404460 X:81084085-81084107 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1193458032 X:81755047-81755069 CTGGCTTCAGCCCCCTTACTAGG - Intergenic
1193547987 X:82852764-82852786 CTGGCTTCAGCCCCTTTTCCAGG + Intergenic
1193562643 X:83037954-83037976 CCGGCTTCAGCCCCCTTTCCAGG - Intergenic
1193571650 X:83151834-83151856 CTGGCTTCAGCCTCCTTTCCAGG - Intergenic
1193616015 X:83688870-83688892 TTGGCTTCAGCTCCCTTTCCAGG + Intergenic
1193646753 X:84079488-84079510 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1193685410 X:84571643-84571665 TTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1193705168 X:84812631-84812653 CTGGCTTCAGCCCCTTTTCCAGG + Intergenic
1193829985 X:86278705-86278727 CTGGCTTCATCCCCTTTTCCAGG - Intronic
1193878715 X:86896016-86896038 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1193897247 X:87128768-87128790 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1193949313 X:87778574-87778596 TTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1194021240 X:88694677-88694699 CTGGCTTCAGCCCCCTGTCTAGG - Intergenic
1194139842 X:90196122-90196144 TTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1194203132 X:90979045-90979067 CTGGCTTCAGTCTCCTTTTCAGG + Intergenic
1194203505 X:90983470-90983492 CTAGCTTCAGCCCCCTTTCCAGG - Intergenic
1194208521 X:91040150-91040172 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1194242544 X:91469943-91469965 CTGGCTTCAGCCCTCTTTCCAGG - Intergenic
1194264042 X:91733834-91733856 CTGGCTTCAGCCCCCTTCCTAGG + Intergenic
1194315308 X:92369490-92369512 CTGGCTTCAGCTCCCTTTCCAGG + Intronic
1194355762 X:92882135-92882157 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1194391146 X:93319597-93319619 CTGGCTTCAGCCCCCTTTCCGGG - Intergenic
1194419903 X:93660871-93660893 CTGGCTTCAGGCCCCTGTCCAGG - Intergenic
1194515347 X:94845169-94845191 CTGGCTTCAGCCCCTTTTCCAGG + Intergenic
1194545126 X:95225129-95225151 CAGGCTTCAGCCCCCTTTCAGGG - Intergenic
1194559523 X:95403562-95403584 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1194576371 X:95618897-95618919 CTGACTTCAGCCCCCTTTCCAGG + Intergenic
1194580563 X:95665940-95665962 CTGGCTTCAGCCCCCTTCCTGGG - Intergenic
1194623002 X:96196388-96196410 CTGGATTCAGCCCCCTTTCTAGG - Intergenic
1194624760 X:96214691-96214713 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1194643424 X:96429565-96429587 CTGGCTTCAGCCCCCCTTCCAGG + Intergenic
1194708105 X:97200355-97200377 CTGGCTTCAGCCACATTTCCAGG - Intronic
1194771780 X:97915422-97915444 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1194783145 X:98049333-98049355 TTGGCTTCAGCCCTCTTTCCAGG + Intergenic
1194798415 X:98240816-98240838 CTAGCTTCAGCCCCCTTTCGAGG + Intergenic
1194837493 X:98699089-98699111 CTGGCTTCAGCCCCCTTTCAAGG + Intergenic
1194954436 X:100162552-100162574 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1194959087 X:100214750-100214772 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1194961066 X:100236441-100236463 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1194963988 X:100266991-100267013 CTAGCTTCAGCCCCCTTTCCAGG - Intergenic
1195102278 X:101567021-101567043 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1195127454 X:101822504-101822526 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1195140081 X:101950345-101950367 CTGGCTTCAACCCCCTTTCCAGG - Intergenic
1195150313 X:102061159-102061181 TTGGCTTCAGACCCATTTCTAGG + Intergenic
1195434712 X:104829106-104829128 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1195435936 X:104843382-104843404 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1195469018 X:105212127-105212149 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1195519270 X:105812428-105812450 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1195730298 X:107959906-107959928 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1195810653 X:108825193-108825215 CTGGCTTCAGTCCCCTTTACAGG + Intergenic
1195842732 X:109192173-109192195 CTGGCTTCAGCCCTCTTACCAGG - Intergenic
1195844262 X:109209268-109209290 CTGGCTTCAGTCACCTTTCTAGG + Intergenic
1195985553 X:110626479-110626501 CTGGCTTCAGCACTCTTTCCAGG - Intergenic
1196133380 X:112181343-112181365 CTGGCTTCAGCCCCCTTTTCAGG - Intergenic
1196269832 X:113697891-113697913 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1196273182 X:113735977-113735999 CTGGCTTCAACCCCCTTTCCAGG + Intergenic
1196281195 X:113825493-113825515 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1196312363 X:114183646-114183668 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1196467032 X:115983148-115983170 CTGGCTTCAGCCCCCTTTTCAGG - Intergenic
1196476466 X:116092168-116092190 CTGGCTTCAGCCCTTTTTCCAGG + Intergenic
1196545750 X:116962553-116962575 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1196571259 X:117268530-117268552 CTGGCTTCAGCCCCTTTTCCAGG - Intergenic
1196576471 X:117324886-117324908 CTGTCTTGAGAAGGCTTTCCAGG + Intergenic
1196587181 X:117443609-117443631 CTGGCTTCAGCCCCCTTTGCAGG - Intergenic
1196602971 X:117623065-117623087 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1196946612 X:120833039-120833061 CTGGCCACAGCCCCCTTTCCAGG + Intergenic
1197004102 X:121474846-121474868 TTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1197051168 X:122061196-122061218 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1197142175 X:123129803-123129825 CTGGCTTCAGCCCCCTTTCCTGG - Intergenic
1197157205 X:123283408-123283430 CTGGCTTCAGCCCCCTTTCCAGG - Intronic
1197184725 X:123573657-123573679 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1197191075 X:123648476-123648498 GTGGCTTCAGCCCCCTTTCCAGG - Intronic
1197277955 X:124501870-124501892 CTGGCTTCAGATCTGTTTCCCGG + Intronic
1197319086 X:125006030-125006052 CTGGTTTCAGCCCCCTTTCCAGG - Intergenic
1197350151 X:125372727-125372749 CTGGCTTCAGGTCCCTTTCCAGG + Intergenic
1197395614 X:125923311-125923333 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1197505984 X:127305968-127305990 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1197614325 X:128675007-128675029 CTGGCTTTAGCCCCCTTTCCAGG + Intergenic
1197880772 X:131164388-131164410 CTGGCTTCAGCCCCCTTTGCAGG + Intergenic
1197906228 X:131428427-131428449 CTGGCTTCAGCCCCCTTTCCGGG - Intergenic
1197926915 X:131656396-131656418 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1198295410 X:135282467-135282489 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1198518973 X:137433540-137433562 CTGGTTTCAGCCCCCTTTCCAGG - Intergenic
1198645516 X:138802058-138802080 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1198678732 X:139158273-139158295 CTGGCTGCACCCCCCTTTCCAGG - Intronic
1198753520 X:139959079-139959101 CTGGGTTCAGCCCCCTTTCCAGG - Intronic
1198784499 X:140272876-140272898 CTGGCTTCAGCCCCCTTTTCAGG + Intergenic
1199004138 X:142675347-142675369 CTGGCTTCAGCCCCCTTTCAAGG + Intergenic
1199012197 X:142770752-142770774 CTGGCTTCACCCCCCTTTCCAGG + Intergenic
1199067947 X:143442631-143442653 CTGGCTTCAGCCCCCTTTTCAGG + Intergenic
1199094454 X:143723639-143723661 CTGGCTTCAGCCACCTTTCCAGG - Intergenic
1199401598 X:147405428-147405450 CTGGTTTCAGCCCCCTTTCCAGG - Intergenic
1199436583 X:147819536-147819558 GTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1199452232 X:147989968-147989990 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1199455052 X:148019543-148019565 CTTTCTTCGGACAGCTTTCCAGG + Intronic
1199477382 X:148260382-148260404 GTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1199524914 X:148781676-148781698 CTGGCTTCAGCCTTCTTTCCAGG + Intronic
1199801194 X:151252880-151252902 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1199830664 X:151546219-151546241 CTGGCTTAAGCCCCCTTTCCAGG - Intergenic
1200333206 X:155319723-155319745 CTAGCTTCAGCCCCCTTTCCAGG - Intronic
1200365425 X:155657589-155657611 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1200485588 Y:3765091-3765113 TTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1200548964 Y:4554471-4554493 CTGGCTTCAGTCTCCTTTTCAGG + Intergenic
1200549336 Y:4558909-4558931 CTAGCTTCAGCCCCCTTTCCAGG - Intergenic
1200623356 Y:5481025-5481047 CTGGCTTCAGCTCCCTTTCCAGG + Intronic
1200740297 Y:6846808-6846830 CTGGCTTCAGCCCCCTTTCCAGG + Intergenic
1201371491 Y:13269478-13269500 CTGGCTTCAGCCCCCTTTCCAGG + Intronic
1201394781 Y:13536798-13536820 CTGGCTTCAGCCCCCCTTGCAGG + Intergenic
1201498690 Y:14618070-14618092 CTGGCTTCAGCCCCCATTCCAGG + Intronic
1201511529 Y:14769712-14769734 CTGGCTTCAGCCCTCTTTCCAGG - Intronic
1201611854 Y:15851881-15851903 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1201692885 Y:16789000-16789022 CTGGCTTCAGCCCACTTTTCAGG - Intergenic
1201707121 Y:16949756-16949778 CTGGCTTCAGCCCCCTTTCCAGG - Intergenic
1201931974 Y:19360467-19360489 CTTGCTTCAACCCCCTTTCCAGG - Intergenic
1201946362 Y:19514962-19514984 ATGGCTTCAGCCCCCTTTCCAGG - Intergenic
1202096311 Y:21251270-21251292 CTGGCTTTAGCCCTCTTTCCAGG + Intergenic
1202342267 Y:23882267-23882289 CTAGCTTCAGCCCCCTTTCCAGG + Intergenic
1202528502 Y:25787818-25787840 CTAGCTTCAGCCCCCTTTCCAGG - Intergenic