ID: 1128861435

View in Genome Browser
Species Human (GRCh38)
Location 15:71077472-71077494
Sequence TTAGGCCAACTTTACATTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128861435_1128861437 11 Left 1128861435 15:71077472-71077494 CCAGGAATGTAAAGTTGGCCTAA No data
Right 1128861437 15:71077506-71077528 TCAATCAATGTAACTCACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128861435 Original CRISPR TTAGGCCAACTTTACATTCC TGG (reversed) Intergenic
No off target data available for this crispr