ID: 1128861856

View in Genome Browser
Species Human (GRCh38)
Location 15:71080790-71080812
Sequence TAGTGGGTAAAGAGGGGGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128861841_1128861856 30 Left 1128861841 15:71080737-71080759 CCTCTTGCCTCAGCCCCACAAGT 0: 3
1: 65
2: 1008
3: 8089
4: 21457
Right 1128861856 15:71080790-71080812 TAGTGGGTAAAGAGGGGGATAGG No data
1128861846_1128861856 17 Left 1128861846 15:71080750-71080772 CCCCACAAGTGGCTGGGACTCTG No data
Right 1128861856 15:71080790-71080812 TAGTGGGTAAAGAGGGGGATAGG No data
1128861849_1128861856 15 Left 1128861849 15:71080752-71080774 CCACAAGTGGCTGGGACTCTGGC No data
Right 1128861856 15:71080790-71080812 TAGTGGGTAAAGAGGGGGATAGG No data
1128861847_1128861856 16 Left 1128861847 15:71080751-71080773 CCCACAAGTGGCTGGGACTCTGG No data
Right 1128861856 15:71080790-71080812 TAGTGGGTAAAGAGGGGGATAGG No data
1128861844_1128861856 23 Left 1128861844 15:71080744-71080766 CCTCAGCCCCACAAGTGGCTGGG No data
Right 1128861856 15:71080790-71080812 TAGTGGGTAAAGAGGGGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128861856 Original CRISPR TAGTGGGTAAAGAGGGGGAT AGG Intergenic
No off target data available for this crispr