ID: 1128864396

View in Genome Browser
Species Human (GRCh38)
Location 15:71103295-71103317
Sequence CCCCAGTCCAGGCCCATGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128864396_1128864400 11 Left 1128864396 15:71103295-71103317 CCAATCATGGGCCTGGACTGGGG 0: 1
1: 0
2: 2
3: 16
4: 167
Right 1128864400 15:71103329-71103351 GTTTCAGTTCTCCAAACATGTGG 0: 1
1: 0
2: 2
3: 13
4: 150
1128864396_1128864401 16 Left 1128864396 15:71103295-71103317 CCAATCATGGGCCTGGACTGGGG 0: 1
1: 0
2: 2
3: 16
4: 167
Right 1128864401 15:71103334-71103356 AGTTCTCCAAACATGTGGTATGG 0: 1
1: 0
2: 1
3: 14
4: 116
1128864396_1128864403 24 Left 1128864396 15:71103295-71103317 CCAATCATGGGCCTGGACTGGGG 0: 1
1: 0
2: 2
3: 16
4: 167
Right 1128864403 15:71103342-71103364 AAACATGTGGTATGGTGTTTAGG 0: 1
1: 0
2: 0
3: 31
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128864396 Original CRISPR CCCCAGTCCAGGCCCATGAT TGG (reversed) Intronic