ID: 1128864401

View in Genome Browser
Species Human (GRCh38)
Location 15:71103334-71103356
Sequence AGTTCTCCAAACATGTGGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 116}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128864392_1128864401 23 Left 1128864392 15:71103288-71103310 CCAGTGGCCAATCATGGGCCTGG 0: 1
1: 0
2: 1
3: 12
4: 172
Right 1128864401 15:71103334-71103356 AGTTCTCCAAACATGTGGTATGG 0: 1
1: 0
2: 1
3: 14
4: 116
1128864398_1128864401 5 Left 1128864398 15:71103306-71103328 CCTGGACTGGGGTCTACCTTGCA 0: 1
1: 0
2: 0
3: 20
4: 192
Right 1128864401 15:71103334-71103356 AGTTCTCCAAACATGTGGTATGG 0: 1
1: 0
2: 1
3: 14
4: 116
1128864391_1128864401 24 Left 1128864391 15:71103287-71103309 CCCAGTGGCCAATCATGGGCCTG 0: 1
1: 0
2: 1
3: 19
4: 122
Right 1128864401 15:71103334-71103356 AGTTCTCCAAACATGTGGTATGG 0: 1
1: 0
2: 1
3: 14
4: 116
1128864390_1128864401 27 Left 1128864390 15:71103284-71103306 CCACCCAGTGGCCAATCATGGGC 0: 1
1: 0
2: 2
3: 9
4: 124
Right 1128864401 15:71103334-71103356 AGTTCTCCAAACATGTGGTATGG 0: 1
1: 0
2: 1
3: 14
4: 116
1128864396_1128864401 16 Left 1128864396 15:71103295-71103317 CCAATCATGGGCCTGGACTGGGG 0: 1
1: 0
2: 2
3: 16
4: 167
Right 1128864401 15:71103334-71103356 AGTTCTCCAAACATGTGGTATGG 0: 1
1: 0
2: 1
3: 14
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128864401 Original CRISPR AGTTCTCCAAACATGTGGTA TGG Intronic