ID: 1128864403

View in Genome Browser
Species Human (GRCh38)
Location 15:71103342-71103364
Sequence AAACATGTGGTATGGTGTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 247}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128864399_1128864403 -3 Left 1128864399 15:71103322-71103344 CCTTGCAGTTTCAGTTCTCCAAA 0: 1
1: 0
2: 1
3: 31
4: 265
Right 1128864403 15:71103342-71103364 AAACATGTGGTATGGTGTTTAGG 0: 1
1: 0
2: 0
3: 31
4: 247
1128864396_1128864403 24 Left 1128864396 15:71103295-71103317 CCAATCATGGGCCTGGACTGGGG 0: 1
1: 0
2: 2
3: 16
4: 167
Right 1128864403 15:71103342-71103364 AAACATGTGGTATGGTGTTTAGG 0: 1
1: 0
2: 0
3: 31
4: 247
1128864398_1128864403 13 Left 1128864398 15:71103306-71103328 CCTGGACTGGGGTCTACCTTGCA 0: 1
1: 0
2: 0
3: 20
4: 192
Right 1128864403 15:71103342-71103364 AAACATGTGGTATGGTGTTTAGG 0: 1
1: 0
2: 0
3: 31
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128864403 Original CRISPR AAACATGTGGTATGGTGTTT AGG Intronic