ID: 1128866037

View in Genome Browser
Species Human (GRCh38)
Location 15:71115737-71115759
Sequence AAGCCGGGTCGGGGCCGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 163}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128866037_1128866045 -5 Left 1128866037 15:71115737-71115759 CCCGCGCGGCCCCGACCCGGCTT 0: 1
1: 0
2: 0
3: 15
4: 163
Right 1128866045 15:71115755-71115777 GGCTTCCGCTGCCCAGGCTCCGG 0: 1
1: 0
2: 0
3: 52
4: 360
1128866037_1128866050 13 Left 1128866037 15:71115737-71115759 CCCGCGCGGCCCCGACCCGGCTT 0: 1
1: 0
2: 0
3: 15
4: 163
Right 1128866050 15:71115773-71115795 TCCGGCTCCCGCTCTCTGGCCGG 0: 1
1: 0
2: 0
3: 16
4: 131
1128866037_1128866054 18 Left 1128866037 15:71115737-71115759 CCCGCGCGGCCCCGACCCGGCTT 0: 1
1: 0
2: 0
3: 15
4: 163
Right 1128866054 15:71115778-71115800 CTCCCGCTCTCTGGCCGGCGGGG 0: 1
1: 0
2: 0
3: 12
4: 104
1128866037_1128866052 16 Left 1128866037 15:71115737-71115759 CCCGCGCGGCCCCGACCCGGCTT 0: 1
1: 0
2: 0
3: 15
4: 163
Right 1128866052 15:71115776-71115798 GGCTCCCGCTCTCTGGCCGGCGG 0: 1
1: 0
2: 5
3: 15
4: 117
1128866037_1128866058 22 Left 1128866037 15:71115737-71115759 CCCGCGCGGCCCCGACCCGGCTT 0: 1
1: 0
2: 0
3: 15
4: 163
Right 1128866058 15:71115782-71115804 CGCTCTCTGGCCGGCGGGGCGGG 0: 1
1: 0
2: 1
3: 15
4: 175
1128866037_1128866049 9 Left 1128866037 15:71115737-71115759 CCCGCGCGGCCCCGACCCGGCTT 0: 1
1: 0
2: 0
3: 15
4: 163
Right 1128866049 15:71115769-71115791 AGGCTCCGGCTCCCGCTCTCTGG 0: 1
1: 0
2: 1
3: 14
4: 179
1128866037_1128866057 21 Left 1128866037 15:71115737-71115759 CCCGCGCGGCCCCGACCCGGCTT 0: 1
1: 0
2: 0
3: 15
4: 163
Right 1128866057 15:71115781-71115803 CCGCTCTCTGGCCGGCGGGGCGG 0: 1
1: 0
2: 0
3: 13
4: 202
1128866037_1128866053 17 Left 1128866037 15:71115737-71115759 CCCGCGCGGCCCCGACCCGGCTT 0: 1
1: 0
2: 0
3: 15
4: 163
Right 1128866053 15:71115777-71115799 GCTCCCGCTCTCTGGCCGGCGGG 0: 1
1: 0
2: 2
3: 17
4: 129
1128866037_1128866059 26 Left 1128866037 15:71115737-71115759 CCCGCGCGGCCCCGACCCGGCTT 0: 1
1: 0
2: 0
3: 15
4: 163
Right 1128866059 15:71115786-71115808 CTCTGGCCGGCGGGGCGGGCTGG 0: 1
1: 0
2: 8
3: 55
4: 489

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128866037 Original CRISPR AAGCCGGGTCGGGGCCGCGC GGG (reversed) Intronic