ID: 1128866257

View in Genome Browser
Species Human (GRCh38)
Location 15:71116922-71116944
Sequence CAATTCCTATAGATTTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 306}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128866257 Original CRISPR CAATTCCTATAGATTTTTGT TGG Intronic
900006577 1:58981-59003 CAATTTCTCTCTATTTTTGTGGG + Intergenic
906352388 1:45073613-45073635 CAATTCTAATAGTTTTTTGGTGG + Intronic
906915915 1:50009768-50009790 CAGTTCTAATAGATTTTTGATGG - Intronic
908175180 1:61548378-61548400 CAGTTCCAATAGTTTTTTGATGG + Intergenic
908957062 1:69644991-69645013 CATTAGCTATAGATTTTTGTAGG - Intronic
910515016 1:88051127-88051149 CAATTCCCATTCATTTTTCTTGG + Intergenic
911006926 1:93235726-93235748 CAATTCCTATTCATTTTTTCAGG - Intronic
911097753 1:94069025-94069047 CAAGTCCTACAGCTCTTTGTTGG + Intronic
912219317 1:107654310-107654332 TAAATCCTTTAGATTATTGTAGG + Intronic
912312296 1:108634866-108634888 GAATTCTAATAGATTATTGTGGG + Intronic
913539879 1:119808604-119808626 CAGTTCCTAAATGTTTTTGTGGG + Intronic
913646842 1:120865011-120865033 AAACTCCTAAAGCTTTTTGTGGG - Intergenic
914079807 1:144397852-144397874 AAACTCCTAAAGCTTTTTGTGGG + Intergenic
914174709 1:145266390-145266412 AAACTCCTAAAGCTTTTTGTGGG + Intergenic
914529436 1:148507878-148507900 AAACTCCTAAAGCTTTTTGTGGG + Intergenic
915862478 1:159460497-159460519 GAAATGCAATAGATTTTTGTAGG + Intergenic
916012841 1:160722024-160722046 CAATTAATATAGATATTTGATGG + Intergenic
916505201 1:165422501-165422523 CAAATCCTACACATTTTTGAAGG - Intronic
916725790 1:167522285-167522307 GAATTCTCATACATTTTTGTGGG + Intergenic
916973096 1:170045340-170045362 CAATTCATATAGGTATCTGTAGG + Intronic
918996148 1:191762761-191762783 TACTTCCTAGAGATATTTGTTGG + Intergenic
919554797 1:199037523-199037545 CAATTTGGATAAATTTTTGTAGG + Intergenic
921614466 1:217250262-217250284 CAAGTCCTACAGATTTTTTTTGG + Intergenic
921746690 1:218748702-218748724 CAGTTCTTATAGTTTTTTGGTGG - Intergenic
921772319 1:219055424-219055446 CATGTCCTAAAGATTTTTGTTGG - Intergenic
922013250 1:221614251-221614273 AAATTGCCATGGATTTTTGTTGG + Intergenic
923327040 1:232889266-232889288 CAATGCCATTAGATTGTTGTAGG - Intergenic
924172295 1:241355985-241356007 CAATTCCTTGAGGTTATTGTAGG - Intronic
1065305350 10:24363534-24363556 ACATTCCTTTAGTTTTTTGTGGG + Intronic
1068386322 10:56332436-56332458 CAATTTCTATATATATTTCTTGG - Intergenic
1068781776 10:60926986-60927008 CAGTTCTGATAGTTTTTTGTGGG - Intronic
1071723834 10:88175942-88175964 GAATTGCTATATATTTTTGCTGG + Intergenic
1071907827 10:90194220-90194242 AAAATCCTAAATATTTTTGTAGG - Intergenic
1074366873 10:112865096-112865118 CAATTCACATAGGTTTTTGATGG - Intergenic
1074718583 10:116244528-116244550 GAATTCCTATATATTTTTATAGG - Intronic
1075270463 10:121044946-121044968 CAATGCCTAGAGATATTTTTTGG + Intergenic
1076455995 10:130596593-130596615 CACTACATATATATTTTTGTTGG + Intergenic
1078051584 11:7969876-7969898 CAATTAATACAGATATTTGTGGG - Intergenic
1078900743 11:15640144-15640166 CAATTCCATAAGATTATTGTGGG + Intergenic
1079592950 11:22203166-22203188 AACTTCCTATATATTTTTTTTGG - Intronic
1080771066 11:35342125-35342147 AGATTCTTATATATTTTTGTAGG + Intronic
1084051776 11:66604889-66604911 CAATTCCTATAGGCTTAAGTTGG - Intronic
1085187892 11:74591864-74591886 CAATTATTAAAGATTTTTGCGGG + Intronic
1085727105 11:78963700-78963722 CAATTCCTATAGGATTTGGCAGG + Intronic
1086038762 11:82449274-82449296 ATATTCATGTAGATTTTTGTGGG - Intergenic
1087987984 11:104708808-104708830 CAATTAGTATTGATTTTTATTGG + Intergenic
1088552684 11:111029593-111029615 TAATTCCTATGTATTTGTGTAGG - Intergenic
1088725056 11:112627259-112627281 CAATTCCTGTAGTTTTCTCTTGG + Intergenic
1093025129 12:14238882-14238904 TAATTTCTATATTTTTTTGTAGG + Intergenic
1093055469 12:14551424-14551446 CTTTTTCTATAGATTTTTTTTGG + Intronic
1094037832 12:26089588-26089610 CATTTCTGATAGATTTTTATTGG + Intergenic
1096948446 12:55436954-55436976 CAACTGCAAGAGATTTTTGTTGG + Intergenic
1097563205 12:61234527-61234549 CAATTCTAATAGTTTTTTGGTGG + Intergenic
1098323113 12:69270553-69270575 CAATTGGTATAAATTTTTGAAGG + Exonic
1098648366 12:72934174-72934196 CAGTTCCAATATATTTTTGATGG + Intergenic
1098916567 12:76262943-76262965 TAGTTCTTATAGATTTTTGGTGG + Intergenic
1099253882 12:80291480-80291502 CAATTCATATAGGTATTTGCAGG - Intronic
1100542382 12:95569934-95569956 TATTTCCTTAAGATTTTTGTTGG + Intergenic
1100734787 12:97514328-97514350 CATTTCCTATAGAATTTTCCAGG - Intergenic
1101126949 12:101645450-101645472 CAACTCCAATATATTTTTTTAGG + Intronic
1105648097 13:22342976-22342998 CAATTTTTATATTTTTTTGTAGG + Intergenic
1106471412 13:30059019-30059041 CAATCCATGTAGATATTTGTAGG + Intergenic
1107582751 13:41808869-41808891 CAATTCTAATAGGTTTCTGTTGG - Intronic
1109450759 13:62511850-62511872 CAATTCCTGTAGTGTTTTATTGG + Intergenic
1109658126 13:65421277-65421299 CAATTCTCAGAGATTTTTGAAGG - Intergenic
1109929473 13:69196494-69196516 AAATTCCAAAATATTTTTGTTGG + Intergenic
1109932022 13:69228288-69228310 CAAGTCCTATAGATAGTTGTGGG - Intergenic
1110203389 13:72881251-72881273 CAATTCTAATAGTTTTTTGGTGG - Intronic
1110501741 13:76236316-76236338 CAGTTCTAATAGATTTTTTTTGG - Intergenic
1111200655 13:84931866-84931888 CAAGTCTTGAAGATTTTTGTGGG - Intergenic
1113557371 13:111249163-111249185 CAAACCCTGTGGATTTTTGTTGG + Intronic
1114297550 14:21343291-21343313 GAATTACTCTGGATTTTTGTGGG + Intronic
1116559743 14:46362782-46362804 CAATTCGTATACATTTTCTTGGG - Intergenic
1116614957 14:47123675-47123697 TCATTTCTATAGATTTTAGTGGG + Intronic
1118413715 14:65509815-65509837 CAATTCTAATAGTTTTTTGGTGG + Intronic
1118420097 14:65593108-65593130 GAAATCCTATAGAATTATGTTGG - Intronic
1119438865 14:74614802-74614824 CAATTCCTAAAGACATATGTTGG + Intergenic
1121991994 14:98567216-98567238 CAATTCCAATTGATCTTTATAGG - Intergenic
1124990118 15:34664850-34664872 AAATTCAGATATATTTTTGTTGG - Intergenic
1125059793 15:35405583-35405605 CAGTTCTAATAGTTTTTTGTTGG + Intronic
1128866257 15:71116922-71116944 CAATTCCTATAGATTTTTGTTGG + Intronic
1130029647 15:80300178-80300200 CCATTCATATATATTTTTGAAGG + Intergenic
1131733465 15:95306553-95306575 GAATTCTTATAGATTCTTGGTGG + Intergenic
1131885347 15:96906416-96906438 CAATTCCTACAGGTGTATGTGGG - Intergenic
1131945341 15:97614206-97614228 CAATTCTAATAGTTTTTTGGTGG - Intergenic
1131947454 15:97641630-97641652 CAATTCTAATAGTTTTTTGGTGG - Intergenic
1132446944 15:101931976-101931998 CAATTTCTCTCTATTTTTGTGGG - Intergenic
1134593086 16:15473178-15473200 AAATTATTATTGATTTTTGTGGG + Intronic
1135823968 16:25709876-25709898 CAATTCCTTTAAAATTTTCTAGG - Intronic
1139657007 16:68394923-68394945 CTTGTCCTATTGATTTTTGTTGG + Intronic
1141485599 16:84337861-84337883 CAGTTCCAATAGTTTTTTGGTGG - Intergenic
1142946216 17:3430810-3430832 TAATTCTTATATATTGTTGTTGG + Intergenic
1144192057 17:12855551-12855573 CATTTCCTATTTATTTTTCTGGG + Intronic
1144555324 17:16277013-16277035 CAACTCATATAGATATTTGAGGG - Intronic
1149221732 17:54422434-54422456 CAATTCTAATAGCTTTTTGAAGG - Intergenic
1149231564 17:54540583-54540605 CAATTCTAACAGATTTTTGGTGG - Intergenic
1150862841 17:68818912-68818934 CACTTCCTAGAGTGTTTTGTGGG + Intergenic
1152871727 17:82757699-82757721 CAAGGCCTATAAATTTTTCTAGG - Intronic
1153135048 18:1907453-1907475 AAATTCCATTTGATTTTTGTAGG - Intergenic
1153172396 18:2331079-2331101 CAATTCCTTGAGATATTTGGGGG - Intergenic
1153259109 18:3205596-3205618 GAATCCCCATACATTTTTGTGGG + Intronic
1153714572 18:7833788-7833810 CAATGCATATTGATTTTTGTAGG + Intronic
1153747233 18:8191949-8191971 CATTTTCTATATATTCTTGTAGG + Intronic
1155129317 18:22915040-22915062 CAATCCCTTTAGATTTATGTTGG + Intronic
1155767548 18:29653787-29653809 TAATGCTTATAGATGTTTGTTGG - Intergenic
1156384013 18:36589859-36589881 CAATTCCAATTGATTTCTCTCGG + Intronic
1156879833 18:42063578-42063600 TAATTCCTCTTGATTTTTATTGG + Intronic
1158117102 18:54007837-54007859 CAATTCTAATAGTTTTTTGGTGG - Intergenic
1158385509 18:56985943-56985965 CAATTACTCTAAATTTGTGTTGG + Intronic
1159378042 18:67619678-67619700 CAATGTCTAGAAATTTTTGTTGG - Intergenic
1159396219 18:67859987-67860009 AAAGTCCTATTGATTTTTATAGG - Intergenic
1160081587 18:75732121-75732143 CATTTTTGATAGATTTTTGTTGG - Intergenic
1160146348 18:76368262-76368284 GCATTCCTATAGAGATTTGTTGG - Intronic
1160638332 19:100557-100579 CAATTTCTCTCTATTTTTGTGGG + Intergenic
1163854906 19:19693769-19693791 CATTTACTATAGTTTTTTGAAGG + Intergenic
1165235370 19:34416574-34416596 CATTTCCTCTACATTTCTGTAGG - Intronic
1165428653 19:35759267-35759289 CAATTCCCATAGATTCCTGGAGG - Intronic
1167268603 19:48495572-48495594 CACTTCCTTGAGATTGTTGTAGG - Intronic
925239882 2:2315498-2315520 ACAATCCTATAGATTTTTGTGGG + Intronic
926600445 2:14838685-14838707 CAACCCCTATAGATCTTTGTTGG + Intergenic
927378390 2:22446493-22446515 CGATTCCCTTAGATTTTTTTAGG - Intergenic
928474335 2:31610747-31610769 CAGTTCTTATAGGTTTTTGGGGG - Intergenic
928745705 2:34412207-34412229 AAATTTTTATAGTTTTTTGTAGG - Intergenic
929227345 2:39524484-39524506 GAATTCCTATAAATTTGTTTTGG - Intergenic
929237148 2:39617462-39617484 TGTTTCCTATAGATTATTGTAGG + Intergenic
929417242 2:41755731-41755753 CAATTCCTACAGGATTTTATGGG + Intergenic
930343791 2:50151938-50151960 TAATTCCTAAAGATTATTATTGG - Intronic
931383907 2:61779222-61779244 CAATTCTGAAGGATTTTTGTTGG - Intergenic
931655439 2:64507189-64507211 AAATACAAATAGATTTTTGTGGG + Intergenic
933135716 2:78732516-78732538 TTTTTCCTATATATTTTTGTAGG - Intergenic
933641115 2:84761492-84761514 CAATTTCTTTATATTTTTTTTGG - Intronic
935584627 2:104789483-104789505 CAATTCCCATACTTTTATGTGGG + Intergenic
935749333 2:106216711-106216733 CAGTTCTAATAGTTTTTTGTTGG - Intergenic
936720171 2:115242012-115242034 AAATTTCTATAGGTTTTTGGGGG + Intronic
937961254 2:127461232-127461254 CAATTCATATAGAACTTTGGGGG + Intronic
939291088 2:140195523-140195545 CAATGACTATAGATCTTTGATGG + Intergenic
939336141 2:140830823-140830845 CAGTTCTAATAGATTTTTGGTGG - Intronic
939756036 2:146112647-146112669 TAATTCTAATAGATTTTTGATGG - Intergenic
939887874 2:147700964-147700986 CAATTCCTTATGATTTTTTTAGG + Intergenic
939911331 2:147987232-147987254 CAATTCCTATAATTTTTATTAGG + Intronic
939977427 2:148734490-148734512 CAAGTACTATAGAATTTTATAGG - Intronic
940942129 2:159573932-159573954 CAATTTTTATATTTTTTTGTAGG - Intronic
941295944 2:163737465-163737487 CAATTCCTAAAGAACTTTGCCGG - Intergenic
941700417 2:168598448-168598470 GCATTCCTATATATTTTTGATGG + Intronic
943126689 2:183803479-183803501 AGATTCCTATAGCTTTTTGCTGG + Intergenic
943222412 2:185127241-185127263 TATTTCCTATAGCTTTTTATTGG - Intergenic
943484331 2:188460460-188460482 AAAATCCTGTAGAATTTTGTAGG + Intronic
944078038 2:195754389-195754411 CAATTCCTATTGATCTTCTTGGG - Exonic
944224680 2:197338047-197338069 CAATACCCAAAGATTTTTGAGGG + Intergenic
944334512 2:198515300-198515322 CAATCCTTATATATTTTAGTGGG + Intronic
944829263 2:203516447-203516469 CAATTGAAAGAGATTTTTGTTGG + Intronic
945014037 2:205495938-205495960 CAATTCCTATAGATTAGTAGTGG + Intronic
945737054 2:213613517-213613539 AAATGCCTATAGATATTTGAGGG - Intronic
947064900 2:226213003-226213025 AAATTCCTATCGATTTTTTGAGG - Intergenic
948133379 2:235618285-235618307 AAATTCCAGTAGGTTTTTGTAGG + Intronic
1170032999 20:11961686-11961708 CAAAACATTTAGATTTTTGTGGG - Intergenic
1170232955 20:14070541-14070563 TAATTTCTATAGATATTTGTGGG + Intronic
1170463089 20:16597308-16597330 CACTCCACATAGATTTTTGTTGG - Intergenic
1170790057 20:19500591-19500613 CATTTCATATAGATTTATGGAGG - Intronic
1172795922 20:37537518-37537540 CATTTCCTACACACTTTTGTGGG - Intergenic
1173054286 20:39596322-39596344 CCATTTTTATAGAGTTTTGTAGG - Intergenic
1173661785 20:44739530-44739552 GAATCCCTCTAGATTCTTGTGGG - Intergenic
1177970458 21:27782994-27783016 CAATTCTAATAGATTTTTGGTGG - Intergenic
1178768231 21:35475636-35475658 CAATTCATCTAGATTTTTACAGG - Intronic
1181641274 22:24200760-24200782 CAAATAGAATAGATTTTTGTGGG + Intergenic
1182158395 22:28097571-28097593 CAATTCCTTTACATTTTTTGTGG - Intronic
1182855982 22:33518000-33518022 CAACTCCTACAGATTTTTCTGGG + Intronic
1183274177 22:36881324-36881346 CAATTCTTATAATTTTTTGTTGG - Intergenic
1185264231 22:49890577-49890599 CAATTCTTCAAGAGTTTTGTTGG - Intergenic
951246892 3:20351519-20351541 CAATTTTTAAACATTTTTGTGGG + Intergenic
951672231 3:25197552-25197574 CAATTCTAATAGTTTTTTGGTGG - Intronic
951960086 3:28308609-28308631 CATTTTCTTTAGATTTTTGGAGG + Intronic
953046729 3:39299615-39299637 CAGTTCCAATAGTTTTTTGGTGG - Intergenic
953235992 3:41107663-41107685 CAATTCCTTTACATTTGTGGAGG + Intergenic
953379076 3:42453118-42453140 CAATTGGCATAGACTTTTGTTGG + Intergenic
955327881 3:58023390-58023412 CAATTCTAATAAATTTTTATTGG + Intronic
956831485 3:73053532-73053554 CAATTGCTATAGATTAATTTTGG + Intronic
956852252 3:73240291-73240313 CAAATGCTACTGATTTTTGTAGG + Intergenic
957691682 3:83579150-83579172 CAACTCCTACAGAATTTTGATGG + Intergenic
959124562 3:102274978-102275000 CAATTCTAATAGTTTTTTGGTGG + Intronic
959762207 3:109978495-109978517 TAATACCTATAGATGTTTCTTGG + Intergenic
960064459 3:113355202-113355224 CAATTTCAATAGGTTTTTGGGGG - Intronic
960189109 3:114681720-114681742 CACTTCCAAAAGATTGTTGTAGG - Intronic
960263368 3:115593205-115593227 CGTTTCCTTTAGGTTTTTGTAGG - Intergenic
963033409 3:141002073-141002095 CAATTCCTATCCATTTATTTGGG - Intergenic
963652460 3:147998606-147998628 TAATTCGTATATATTTTTGAAGG + Intergenic
966331228 3:178816972-178816994 TAATTCATATTTATTTTTGTTGG - Intronic
966468873 3:180264737-180264759 TAAGTCCTATAAATGTTTGTTGG - Intergenic
967545358 3:190719972-190719994 CCATGTCTATAGATTTTTATTGG - Intergenic
967738299 3:192977463-192977485 CAATTCTAATAGTTTTTTGGTGG - Intergenic
967856359 3:194120510-194120532 TATTTCCTAAATATTTTTGTAGG - Intergenic
969193107 4:5539120-5539142 GAAATCCAATTGATTTTTGTTGG - Intergenic
969996251 4:11316194-11316216 TAAGTCCTGTAGATGTTTGTAGG - Intergenic
970181599 4:13402958-13402980 TAATTTCTGTATATTTTTGTAGG + Intronic
970733641 4:19139603-19139625 CTTTTCTTATAGATTATTGTTGG - Intergenic
971210557 4:24611910-24611932 CAATTCATCTAGAATTTTTTAGG - Intergenic
972022200 4:34329482-34329504 CAGTTCTAATAGATTTTTGGTGG - Intergenic
973072548 4:45882419-45882441 CAATTGTTATACATTTCTGTGGG + Intergenic
973186814 4:47339596-47339618 CTTTTCCTATAGGTTGTTGTGGG - Intronic
973625496 4:52768056-52768078 CAATTCTAATAGTTTTTTGGTGG + Intergenic
974521945 4:62992809-62992831 CAACTCCTGTAGATTCTTGAAGG + Intergenic
974708125 4:65550061-65550083 AAATTCCTAAGGATTTTTGTGGG - Intronic
975412010 4:74064175-74064197 CAATTCATACAGATGTTTGCAGG + Intergenic
975662724 4:76703791-76703813 AAATTCCTTTTGATTTATGTTGG - Intronic
976131255 4:81886631-81886653 CATTTCCTATGTTTTTTTGTAGG - Intronic
976718569 4:88149011-88149033 GAATTCCTGCAGATTTTTGTGGG - Intronic
977253847 4:94718474-94718496 CAGTTCTTATAGTTTTTTGATGG - Intergenic
977617277 4:99100635-99100657 CATTTCTTTTATATTTTTGTAGG + Intergenic
977812481 4:101373312-101373334 CAGTTCTAATAGATTTTTGGTGG + Intergenic
977914291 4:102573861-102573883 CAATTTCTATAGATTTGTTTGGG + Intronic
978648278 4:110968763-110968785 CAATTCCAATAGGGGTTTGTAGG + Intergenic
978769345 4:112437796-112437818 CAATTCCCCTTGATTTTTGGTGG + Intronic
979824554 4:125217055-125217077 CAAATCCTATAGATGGTTGTAGG + Intergenic
980058227 4:128099857-128099879 CAAGTCCTATAGATAATCGTGGG - Intronic
981592173 4:146376240-146376262 TAAATCCTTTAGAATTTTGTGGG - Intronic
981844238 4:149148854-149148876 TAATTGCTATAGATTTGTTTAGG - Intergenic
981975994 4:150728958-150728980 CAGTTCTTATAGTTTTTTGGTGG - Intronic
983046488 4:162993059-162993081 ATATTTCTATAGATTTTTGAGGG - Intergenic
983258324 4:165427447-165427469 CATTTTCTATAGGTATTTGTAGG + Intronic
983284141 4:165717747-165717769 AAATTCCTCTAGTTTTTTGGGGG + Intergenic
984425332 4:179577653-179577675 CTATTCTAATAGATTTTTGGTGG - Intergenic
984447587 4:179856479-179856501 TAATTCCAATATATATTTGTTGG + Intergenic
986503051 5:8420752-8420774 GCTTTCCTATAGATTTTTTTGGG - Intergenic
986513318 5:8532391-8532413 CATTTAATATATATTTTTGTTGG - Intergenic
988024891 5:25672867-25672889 CAATTCTTAGAAATTTTAGTGGG + Intergenic
989472178 5:41832609-41832631 CAAGGCCTGTAGATGTTTGTTGG - Intronic
990029522 5:51240154-51240176 CAAGTGCTAGAGATTTTTCTTGG + Intergenic
990415181 5:55579541-55579563 CAATCCCTCTAGATCTTGGTGGG - Intergenic
991257129 5:64627305-64627327 CAATTCTAATAGTTTTTTGGTGG - Intergenic
991374759 5:65955216-65955238 AAATTCCTAAATATTCTTGTTGG - Intronic
991674926 5:69081234-69081256 CAATTACTAAAGCTGTTTGTCGG + Intergenic
992829402 5:80579710-80579732 CAATGCCTTCAGATTTTTGAAGG + Intergenic
993002025 5:82390410-82390432 ACATTTCTATAGATTTTTCTAGG - Intergenic
995202368 5:109440576-109440598 CAATTACTAGGTATTTTTGTAGG + Intergenic
995268239 5:110190134-110190156 CAATTCTAATAGATTTTTGGTGG + Intergenic
995431597 5:112085319-112085341 CTATTTCTATAGGTTTTTGGGGG + Intergenic
995708695 5:115012610-115012632 CTGTTCCTATAAAGTTTTGTTGG + Intergenic
996001208 5:118366407-118366429 GAATTCTTCTAGATTTTAGTAGG - Intergenic
996081580 5:119263693-119263715 CAAGTCCTATTTATTTTTGGAGG - Intergenic
998180846 5:139939834-139939856 CCATTGCTATATATTTTTTTTGG - Intronic
998700589 5:144694368-144694390 AAATTCCAATAGCTTTTTTTTGG + Intergenic
1004290609 6:14363643-14363665 CAATTCCTTTATTTTTGTGTGGG + Intergenic
1004489606 6:16101674-16101696 CAATTCCTATATTTTCTTTTAGG + Intergenic
1005400560 6:25429064-25429086 CAATTCCTACATATTTTGCTGGG + Intronic
1008144610 6:47876291-47876313 CAATATCTATAGATTTGAGTGGG - Intergenic
1008678106 6:53843236-53843258 AGAAACCTATAGATTTTTGTAGG - Intronic
1008860760 6:56147164-56147186 CAATTACTAGAGATTTATGTTGG - Intronic
1009526572 6:64754228-64754250 CATTTTCTTTAGATTTTTCTGGG - Intronic
1010189277 6:73178285-73178307 CCCCTCCTGTAGATTTTTGTTGG - Intronic
1010914387 6:81597733-81597755 CAACTGCTTTACATTTTTGTTGG - Intronic
1012126698 6:95438297-95438319 CAACTAGTATAGATTTTTTTAGG + Intergenic
1015669235 6:135668932-135668954 CAATTCCTATACATTTAAGCTGG + Intergenic
1015959854 6:138636524-138636546 CAGTTCCAATAGTTTTTTGATGG - Intronic
1016788864 6:148044785-148044807 AAATTTCTATAGTGTTTTGTGGG - Intergenic
1018233677 6:161701860-161701882 AAATTCCCATAGATTTTTTTGGG - Intronic
1020490790 7:8781445-8781467 CAATTCCTATGGTATTTTGCTGG - Intergenic
1020498462 7:8886861-8886883 AAATTCTTATAAATTTTTGTGGG + Intergenic
1021124159 7:16831216-16831238 CAGTTCCAATAGTTTTTTGGTGG - Intronic
1021141116 7:17026705-17026727 AAATTTCTAGAGATTTTTGAGGG + Intergenic
1021283388 7:18747951-18747973 CTATTCCTGAAGATTTTTTTTGG + Intronic
1023027167 7:36061316-36061338 TAATTTTTATAAATTTTTGTGGG - Intergenic
1023222893 7:37938375-37938397 CAATTCCATGAGATTTTTGATGG - Intronic
1023610092 7:41964284-41964306 CAACTCCTATTGATTTCCGTTGG + Exonic
1023707420 7:42955854-42955876 CAATTCATACAGATATTTGCAGG - Intergenic
1028264343 7:88704834-88704856 CAGTTCTAATAGTTTTTTGTTGG + Intergenic
1028503027 7:91539910-91539932 GAATTCCAATATATTTTTGTGGG + Intergenic
1028675460 7:93455331-93455353 CAATTTCAATAAATATTTGTAGG + Intronic
1030734564 7:113031341-113031363 TAATTCCACTTGATTTTTGTTGG - Intergenic
1030944558 7:115701069-115701091 CAATTACTAACGAATTTTGTAGG - Intergenic
1031012474 7:116538135-116538157 CAATTTCTACAGACATTTGTGGG + Intronic
1033709668 7:143929138-143929160 CAATTTCTATAGATTAGTGAAGG + Intergenic
1034933063 7:155179239-155179261 CAATTCCTATACATGTGTTTTGG - Intergenic
1035869814 8:3125611-3125633 CAATTCCTAAAGACTTCTGAAGG + Intronic
1037030992 8:14104942-14104964 CATTTCCTAAAGATTTTTTTTGG - Intronic
1039095924 8:33885339-33885361 CAATGTCTACAGATTTTTATAGG + Intergenic
1039307972 8:36284479-36284501 CAGTTCAAATAGTTTTTTGTTGG + Intergenic
1041228483 8:55725018-55725040 CAATTCATATAGGTATTTGCAGG - Intronic
1042052539 8:64726867-64726889 CAATTCCTGTAGCTCTTTGGAGG + Intronic
1042293048 8:67189763-67189785 CAATTTCTATATATATTTGGGGG - Intronic
1042361859 8:67892510-67892532 GAATACCTATAGATTTTGGAGGG - Intergenic
1042644372 8:70969760-70969782 CTATTCCAATAGGTTTTTGAGGG + Intergenic
1042802578 8:72735987-72736009 CAATTTCCATATATTTTTGCAGG + Intronic
1042880158 8:73478764-73478786 CAATTCTTAATGATTTTTGGGGG - Intronic
1043235708 8:77862923-77862945 CAGTTCTAATAGATTTTTGGTGG - Intergenic
1043276223 8:78397602-78397624 TAATTCTTATATATTCTTGTTGG + Intergenic
1044497206 8:92901057-92901079 GAAATCCTACTGATTTTTGTAGG + Intronic
1045648148 8:104319241-104319263 GAATTCATTTAGCTTTTTGTGGG + Intergenic
1046509849 8:115188262-115188284 CATTTCATATAGGTGTTTGTGGG - Intergenic
1047087625 8:121536296-121536318 CAATTTCTCTAGCTGTTTGTAGG + Intergenic
1047098824 8:121654492-121654514 CAATTCCTTTAAATTTTTTGAGG + Intergenic
1047902118 8:129434357-129434379 CACTTCTAATAGATTTTTGGTGG - Intergenic
1050755130 9:8992898-8992920 GCATTCCTATAAATATTTGTTGG + Intronic
1050802133 9:9628774-9628796 AAATTTCTATACATTTTTATAGG + Intronic
1051620006 9:19041054-19041076 CAATTCTAATAGTTTTTTGGTGG - Intronic
1051650541 9:19319911-19319933 TAATTCCTATTGCTTTTTTTGGG - Intronic
1052019783 9:23512332-23512354 CCATATCTATAGATTTTTTTTGG + Intergenic
1052345562 9:27406184-27406206 CAATTCTAATAGTTTTTTGGTGG - Intronic
1052454165 9:28673140-28673162 AAATTCCTTCAGAGTTTTGTGGG + Intergenic
1055886188 9:81065830-81065852 CATTTCCTCTAGATTTTTATCGG + Intergenic
1059047272 9:110882539-110882561 CAATTCCTACACACTTTTGAAGG + Intronic
1059093298 9:111384977-111384999 CAATTCCTCTGAATTTTTCTTGG - Intronic
1059836275 9:118157545-118157567 GAACTCTTATAGATTTTTTTTGG + Intergenic
1060049900 9:120371080-120371102 CAATTCTCAAAGATTTTTTTTGG + Intergenic
1060760454 9:126243233-126243255 GAAATCCTATTGATTTCTGTAGG + Intergenic
1061774523 9:132952167-132952189 GAAATTCTATTGATTTTTGTAGG + Intronic
1062671202 9:137710574-137710596 CTATTTCTATAATTTTTTGTAGG + Intronic
1186738657 X:12494324-12494346 CAATATCTAGAGATTTTTGGTGG - Intronic
1187095595 X:16144472-16144494 CAATTCCTACAGACTTCCGTAGG + Intronic
1187101075 X:16192906-16192928 CAATTCTTATATTTTTTTGTTGG + Intergenic
1187134304 X:16531793-16531815 TAATTTCAATAGGTTTTTGTGGG - Intergenic
1187636989 X:21239516-21239538 TAATGCCTGCAGATTTTTGTTGG - Intergenic
1187655012 X:21462413-21462435 CAATTCTAATAGTTTTTTCTTGG + Intronic
1190874558 X:54450345-54450367 CCACTCCTATTGCTTTTTGTGGG - Intronic
1191798066 X:65044406-65044428 CAAAACATATAGACTTTTGTAGG + Intergenic
1191939719 X:66465132-66465154 CATTTTCTAAAGGTTTTTGTCGG + Intergenic
1193245813 X:79227861-79227883 CAATTCCAATAGTTTTTTCATGG + Intergenic
1193291826 X:79782253-79782275 CAACTCCTTTACAATTTTGTTGG + Intergenic
1193540580 X:82767025-82767047 CAATTCTTATAGATTATCGGGGG + Intergenic
1193921767 X:87436704-87436726 CCATTCCCATAAATTTTGGTAGG - Intergenic
1194614189 X:96081040-96081062 CAAATACTACTGATTTTTGTTGG - Intergenic
1194798724 X:98244361-98244383 CAATTAATACATATTTTTGTAGG - Intergenic
1195877772 X:109560167-109560189 TATTTCTTATTGATTTTTGTAGG + Intergenic
1197341601 X:125282212-125282234 AAATTCCTATATATTTGTTTTGG + Intergenic
1197446829 X:126561052-126561074 CAGTTCTAATAGATTTTTGTTGG + Intergenic
1197485467 X:127044935-127044957 GAATTCATATATATTTTTGGTGG - Intergenic
1197592996 X:128431876-128431898 CATTTACTATACAGTTTTGTGGG + Intergenic
1197598729 X:128500758-128500780 CAAGTTCTCTATATTTTTGTGGG + Intergenic
1199174618 X:144771899-144771921 CAGTTCTAATAGATTTTTGGTGG + Intergenic
1199646015 X:149912822-149912844 CAATTCTAATAGTTTTTTGGTGG - Intergenic
1200539013 Y:4436213-4436235 CAATTCTCAGAGTTTTTTGTTGG + Intergenic
1200768377 Y:7101033-7101055 CAAGTCCTACAGAATTTTCTAGG + Intergenic
1201446979 Y:14067902-14067924 AAAATCCTACTGATTTTTGTAGG - Intergenic
1201459120 Y:14202771-14202793 CAGTTTCTTTAGATTTTTTTTGG + Intergenic