ID: 1128866620

View in Genome Browser
Species Human (GRCh38)
Location 15:71119443-71119465
Sequence ACATGCTGCCTGGGATAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 205}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128866620_1128866628 25 Left 1128866620 15:71119443-71119465 CCACTTTATCCCAGGCAGCATGT 0: 1
1: 0
2: 1
3: 15
4: 205
Right 1128866628 15:71119491-71119513 TGACTCTAAGGAGTGAGCAATGG 0: 1
1: 0
2: 1
3: 18
4: 146
1128866620_1128866623 -7 Left 1128866620 15:71119443-71119465 CCACTTTATCCCAGGCAGCATGT 0: 1
1: 0
2: 1
3: 15
4: 205
Right 1128866623 15:71119459-71119481 AGCATGTTCCTTTTTGACAGAGG 0: 1
1: 0
2: 0
3: 10
4: 201
1128866620_1128866625 13 Left 1128866620 15:71119443-71119465 CCACTTTATCCCAGGCAGCATGT 0: 1
1: 0
2: 1
3: 15
4: 205
Right 1128866625 15:71119479-71119501 AGGCCCTGACTTTGACTCTAAGG 0: 1
1: 0
2: 0
3: 7
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128866620 Original CRISPR ACATGCTGCCTGGGATAAAG TGG (reversed) Intronic
900542471 1:3210327-3210349 ACATGCTCCCTGGGATCCATGGG + Intronic
900599220 1:3496014-3496036 ACAGGCTGCCGGGGAGGAAGTGG + Exonic
900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG + Intronic
905651158 1:39657926-39657948 AGGTGCTGCCTGGGGTGAAGTGG - Intergenic
907395210 1:54184982-54185004 ACATGGTGCCTGGCACAGAGTGG - Intronic
909462498 1:75933564-75933586 ACATTCTGCCTGGTTTATAGAGG - Intergenic
912025190 1:105161160-105161182 GCTTGCTGCATGGGATAAAGTGG - Intergenic
912883171 1:113439179-113439201 ACATCCTGGGTGGGATAGAGTGG + Intronic
914728175 1:150346438-150346460 TTATGCTGCATCGGATAAAGTGG + Exonic
917514591 1:175697078-175697100 GCAAACTGCCTGAGATAAAGAGG - Intronic
918466173 1:184823671-184823693 ACCTGCTGCCTAAGATGAAGGGG - Exonic
919249346 1:195031827-195031849 CCATTCTGACTGGGATAAAGTGG + Intergenic
919547146 1:198938164-198938186 ACATTCTGCCTTACATAAAGTGG - Intergenic
920950961 1:210571288-210571310 ACATGCAGCCTGGGTAAATGAGG + Intronic
923430225 1:233912722-233912744 ACATCCTGGGTGGGATGAAGTGG + Intronic
924057463 1:240138102-240138124 AAATGCTGCCTGGGACCCAGAGG + Intronic
1062960944 10:1573349-1573371 GGCTGCTGCCTGGGATAAAAGGG + Intronic
1063686584 10:8242418-8242440 ACCTGCTGCTTGGCATAGAGTGG + Intergenic
1066577135 10:36838465-36838487 ACAGGCTTCGTGGGATAAAGGGG + Intergenic
1068432833 10:56954697-56954719 TCATTCTGGCTGGGGTAAAGTGG + Intergenic
1068910395 10:62373877-62373899 CCCTGCTGCTTGGGATGAAGAGG + Intergenic
1069085037 10:64129166-64129188 ACAGGATAGCTGGGATAAAGAGG + Intergenic
1069223958 10:65918071-65918093 AAAATCTGCCTGGGTTAAAGAGG + Exonic
1070637854 10:78143604-78143626 TCTTCCTGCCTGGGATATAGAGG - Intergenic
1073767195 10:106695648-106695670 ACACCATGCCTGGCATAAAGTGG + Intronic
1075783894 10:125035116-125035138 AGATGCTGCCGGGGATGAGGTGG - Intronic
1075895243 10:125989416-125989438 AAATGCTACCTGGAATAAAACGG - Intronic
1076431431 10:130405894-130405916 GAATGTTGCCAGGGATAAAGAGG + Intergenic
1077010881 11:378809-378831 AACTGCTGCCTGGGGGAAAGGGG + Intronic
1080300711 11:30782224-30782246 ATATGGTGCCTGGAATGAAGAGG + Intergenic
1083782100 11:64924025-64924047 CCAGGCTGCCTGGGATGAGGTGG + Intronic
1085398963 11:76224197-76224219 ACAGGTTGCCTGGGTTACAGTGG - Intergenic
1085871236 11:80351676-80351698 ACATGCTGCCTAAGGTAAATAGG - Intergenic
1086049307 11:82569856-82569878 CCATTCTGGCTGGGGTAAAGTGG + Intergenic
1093186946 12:16030889-16030911 TAAGGCTGCCTGGGAGAAAGTGG - Intronic
1096331326 12:50715662-50715684 ACCTGCTGGCTGGGATGTAGAGG - Intronic
1098270200 12:68762509-68762531 ACATTCTGCCTGGAGTAAAGTGG + Intronic
1101899686 12:108782212-108782234 AAAAGCTGCCTGGGGTGAAGTGG + Intergenic
1102254556 12:111407987-111408009 ACCTGCTGCCTGGCAAAGAGAGG + Intronic
1104068740 12:125327109-125327131 ACATGCAGAGTGGGAAAAAGAGG - Intronic
1105951537 13:25233529-25233551 ACAGGCTGACTGGGATAGATGGG - Intergenic
1108208375 13:48113926-48113948 ACATGGTGACTAGGTTAAAGGGG + Intergenic
1112311419 13:98320501-98320523 ATCTGCTGCTAGGGATAAAGAGG - Intronic
1114432263 14:22671576-22671598 AGATGCTGCCTGGGAGCCAGTGG - Intergenic
1114722698 14:24899269-24899291 ACATTCTTACTGGAATAAAGGGG - Intronic
1115133818 14:30085769-30085791 CCATGCTGCATGGGATATGGGGG - Intronic
1118956625 14:70488809-70488831 ACCTGCTGCCTTGAAGAAAGGGG + Intergenic
1119434658 14:74590097-74590119 CCATTCTGGCTGGGATAAGGTGG - Intronic
1121981999 14:98462450-98462472 ACATGCTGCCTTGGCCAAAAGGG + Intergenic
1123115948 14:105894118-105894140 ACATCCTGGCTGGAATCAAGAGG - Intergenic
1124014090 15:25862011-25862033 ACCTGCTTCCTGGGGGAAAGAGG - Intronic
1125973036 15:43927582-43927604 ATATGCTGCATGGGATAGAGTGG - Intronic
1126506589 15:49411518-49411540 ACATGCTGAGTGGTATAAAATGG + Intronic
1127483168 15:59395841-59395863 ACAGGCTGACTAGGAGAAAGGGG - Intronic
1128866620 15:71119443-71119465 ACATGCTGCCTGGGATAAAGTGG - Intronic
1131487535 15:92834079-92834101 ACATGGTCCCTGGGATGAAAGGG - Intergenic
1133135449 16:3708056-3708078 ACATGCTCCTTGGGAGGAAGAGG + Intronic
1134031203 16:10993868-10993890 ACATGCTGCTTGGCATTGAGAGG + Intronic
1136560521 16:31036417-31036439 ACATGTTGCCTGGGCGAAACAGG - Intronic
1137962979 16:52903183-52903205 AAATGCTGCCAGGGATATGGAGG + Intergenic
1138315698 16:56068250-56068272 ACATGCTCACTGGCGTAAAGGGG + Intergenic
1138861084 16:60758475-60758497 TGATGTTTCCTGGGATAAAGTGG - Intergenic
1139440650 16:66964988-66965010 CCATGCTGCCTGGGGCAGAGAGG - Intronic
1144803030 17:17944198-17944220 TCATGGTGCCTGGCACAAAGTGG + Intronic
1145241604 17:21243638-21243660 CCATGCTGCCTGGGGCAAGGGGG - Intronic
1145797250 17:27662888-27662910 ACAGGCTGCCTGGAAGAAGGTGG + Intergenic
1145811651 17:27767829-27767851 ACAGGCTGCCTGGAAGAAGGTGG + Exonic
1149329254 17:55564599-55564621 ACATTCTTCCTGAGATTAAGCGG - Intergenic
1149330032 17:55570887-55570909 CCATTCTGGCTGGGATAAGGTGG + Intergenic
1149567494 17:57650452-57650474 AGATGCTGCCTGGAAGAAATGGG + Intronic
1150598335 17:66626968-66626990 ACATGGTGGCTGGAATAAAGGGG - Intronic
1151818073 17:76481366-76481388 GCATGCTGCCTGAGGTAAGGGGG - Exonic
1151985787 17:77542655-77542677 CCAAGCTTCCTGGGACAAAGGGG - Intergenic
1155878264 18:31113017-31113039 AAATACTGCCAAGGATAAAGGGG - Intergenic
1156640051 18:39083447-39083469 AAATGTTATCTGGGATAAAGAGG - Intergenic
1159964545 18:74582336-74582358 ACATGCTGCCAGTGATGGAGTGG - Intronic
1160986134 19:1839803-1839825 GCATAGTGCCTGGGATACAGAGG + Intronic
1165178249 19:33945929-33945951 GCATGCTGCCTGGCATACATAGG + Intergenic
1166541824 19:43610809-43610831 ACTGGCTGCCTGGGATGAGGAGG - Intronic
1166718438 19:44984030-44984052 AAATGCTGCCGGGGAGGAAGGGG - Intronic
1167983639 19:53297311-53297333 ACAGGCTGCCTGGGATCCTGTGG + Intergenic
1168254658 19:55158746-55158768 ACAGGGTGCCTGGGAACAAGGGG + Exonic
925990423 2:9250187-9250209 ACACGCTGCCTGACACAAAGTGG + Intronic
926323682 2:11766297-11766319 ACAAGCTGCCTGGGCTCAAGGGG + Intronic
926743619 2:16132603-16132625 CCATTCTGGCTGGGATAAGGTGG - Intergenic
927336083 2:21926152-21926174 ACTTGCACCCTGGGCTAAAGCGG - Intergenic
928091206 2:28376136-28376158 CCATGCTTCCTGGGACAGAGGGG + Intergenic
928352328 2:30570800-30570822 TGATGCTGCCTGAGATAACGGGG + Intronic
930238205 2:48908218-48908240 AATTGATGCCTGGGATGAAGTGG + Intergenic
931706898 2:64953845-64953867 ACATGCTGCCTAGCATGCAGAGG - Intergenic
933149576 2:78897655-78897677 CCACCCTGCCTGGAATAAAGAGG - Intergenic
933768772 2:85729802-85729824 ACATCCTGCCTGGGACTCAGAGG - Intergenic
935935087 2:108173764-108173786 CCATGCCGCCTGGGATGAAGGGG - Intergenic
936494100 2:113002874-113002896 AAATGCTGACTGAGATAAACAGG + Intergenic
936848106 2:116862361-116862383 ACATGCTCCCTGGAAGCAAGGGG - Intergenic
937313005 2:120913817-120913839 GAATGCAGCCTGGAATAAAGAGG + Intronic
938950957 2:136254035-136254057 CCAGGCTTGCTGGGATAAAGGGG - Intergenic
939546948 2:143566384-143566406 ACATACTGCCTGGCATCTAGTGG - Intronic
940024921 2:149195979-149196001 AAATGCTGCCTAGTATAATGGGG - Intronic
940845800 2:158640767-158640789 ACATGGTGCCTGGGATGACTGGG + Intronic
941701935 2:168613077-168613099 GTTTGATGCCTGGGATAAAGGGG + Intronic
943919289 2:193681850-193681872 ACATTCTGACTGGTATAAAATGG + Intergenic
944370626 2:198978812-198978834 ACATTCTGGCTGGGGTACAGTGG - Intergenic
946811985 2:223535626-223535648 ACATACTGCCTGTCATGAAGAGG - Intergenic
946952266 2:224889875-224889897 ACATGTTGCCTGAGATTCAGAGG + Intronic
1168749926 20:275264-275286 ACATGGTGCCTGGCATTCAGAGG + Intronic
1170370054 20:15638760-15638782 GCATGCTGACTGGGGCAAAGGGG + Intronic
1172573834 20:35991661-35991683 ACATTCTGACTGGCAGAAAGCGG + Intronic
1174852995 20:54014725-54014747 CCATGCTGCCTGGGATAAAAGGG + Intronic
1175366212 20:58457983-58458005 ACCTTCTGCCTGGGAGAAAAGGG + Intergenic
1179094755 21:38303472-38303494 ACATGGTGCCTGGCAGACAGTGG + Exonic
1182208040 22:28648296-28648318 CCATTCTGGCTGGGATACAGTGG - Intronic
1182418584 22:30237352-30237374 ACATGCTGTTTGGAATAAAGAGG + Intergenic
950228833 3:11258439-11258461 ACATCCTGTCAGGGAGAAAGAGG + Intronic
953912744 3:46901132-46901154 ACATGCTTCCTGGAAGAAAAGGG - Intronic
954169611 3:48790368-48790390 AGATCATGCCTGGGTTAAAGTGG + Intronic
959006225 3:101022987-101023009 CCATTCTGGCTGGGTTAAAGTGG + Intergenic
961638452 3:128349647-128349669 GCATGCTGCCAGGGGCAAAGAGG - Intronic
962470483 3:135703551-135703573 ACATGCAGCCTGGTGTACAGGGG + Intergenic
963557570 3:146811878-146811900 ACATTCTTACAGGGATAAAGGGG + Intergenic
966488288 3:180497032-180497054 ACAAGCAGCCTAGGATAGAGTGG + Intergenic
968636475 4:1683707-1683729 ACAGGCTGCGTGGGAAACAGGGG + Intronic
970611018 4:17725345-17725367 CAGTGCTGCCTGGGAAAAAGAGG + Intronic
971139727 4:23911155-23911177 CCAGGCTGCCTAGAATAAAGTGG + Intergenic
971168457 4:24208404-24208426 CCTGGCTGCATGGGATAAAGTGG + Intergenic
971233997 4:24825159-24825181 ACAGGCTGCAGGGGATAATGAGG + Intronic
973026357 4:45277146-45277168 ACATTTGGCCTGGGAGAAAGAGG + Intergenic
975924745 4:79435525-79435547 AAATCCTGCCTGGAGTAAAGAGG - Intergenic
976486692 4:85613739-85613761 AAATGCTGCCTGTGATAATTTGG - Intronic
976795330 4:88925813-88925835 ACATTCTGCCTTGGATAAGTTGG - Intronic
982022593 4:151218458-151218480 TCATGCAGGCTGGGATACAGTGG + Intronic
982730435 4:158950483-158950505 ACATGGTGCTTGGCATAAATGGG - Intronic
982779365 4:159474635-159474657 CCATTCTGCCTGGTATAAGGGGG - Intergenic
984564032 4:181306398-181306420 AAATGCTTCCTGGGAGAAACTGG - Intergenic
985389324 4:189478658-189478680 TCAGGCTGCCTGGAAAAAAGAGG + Intergenic
985419699 4:189772481-189772503 ACATGATGCCTGGGAAAACGGGG - Intergenic
986046703 5:4044917-4044939 AGATGCTGTCTGGGAGATAGAGG - Intergenic
986221591 5:5773310-5773332 AAATGCTGCCTGAGATAGTGAGG + Intergenic
987625506 5:20394886-20394908 CCATCCTGCCTGGGGTAAGGTGG - Intronic
988845345 5:35121986-35122008 ACATTCTGGGTGGAATAAAGTGG + Intronic
989607595 5:43259469-43259491 CCATTCTGGCTGGGGTAAAGCGG + Intronic
990096004 5:52114002-52114024 ACATCTTGGGTGGGATAAAGAGG + Intergenic
992175036 5:74141536-74141558 AGATGATGCCTGGGAGACAGAGG + Intergenic
993794206 5:92247467-92247489 ACATCCTGAGTGGGATCAAGAGG - Intergenic
996522650 5:124444433-124444455 TCTGGCAGCCTGGGATAAAGTGG - Intergenic
996555957 5:124779074-124779096 GCATGCAGCATGGGAAAAAGAGG - Intergenic
996809266 5:127496347-127496369 AAATGTTGTCAGGGATAAAGAGG + Intergenic
997569353 5:134914199-134914221 ACATTCATCCTGGGAAAAAGAGG + Intronic
997590409 5:135068748-135068770 ACATGCGGGCTGGGATTAGGGGG + Intronic
997752892 5:136365731-136365753 ACATGCTGCCTTATATAACGAGG - Intronic
998035170 5:138908946-138908968 ACATAATGCCTGGGATACAAAGG - Intronic
999714037 5:154344740-154344762 TCATGCTGCCTGGGAAAACTCGG - Intronic
1000582757 5:163054192-163054214 AAATGAGGCCTGGGACAAAGAGG + Intergenic
1001166225 5:169371249-169371271 CCATTCTGTCTGGGGTAAAGTGG - Intergenic
1005364764 6:25065781-25065803 ACATCCTTCCTTGGAAAAAGAGG + Intergenic
1005375484 6:25178088-25178110 ACATGAAGCCTGGAATAGAGTGG + Intergenic
1012123974 6:95403184-95403206 AGATTCTGGCTGGGATAGAGGGG + Intergenic
1012998427 6:105995642-105995664 ATATTCTCCCTGGGAGAAAGAGG - Intergenic
1015908794 6:138146185-138146207 ACATTGTGCCTGGTATATAGTGG - Intergenic
1017919518 6:158859073-158859095 ACACACTGCCTGGCACAAAGTGG + Intergenic
1026212303 7:68316385-68316407 ACATGCCTCCCGTGATAAAGTGG - Intergenic
1027889779 7:83957015-83957037 GCATGATGCCTGGCACAAAGAGG - Exonic
1029849300 7:103445965-103445987 ACATGGGGCCTGGGAGACAGGGG + Intronic
1030842514 7:114373425-114373447 AAATGCTGACTGTGACAAAGTGG + Intronic
1031864036 7:127017977-127017999 ACACGGTGCCTAGGATAAAGTGG - Intronic
1033050740 7:138001940-138001962 AAAGGCTGCCGGGGCTAAAGCGG + Exonic
1037251046 8:16894685-16894707 CCATTCTGGCTGGGATAAGGTGG + Intergenic
1037841050 8:22245431-22245453 ACATGTTGCCTGGGAGAGAAGGG - Exonic
1039672893 8:39623538-39623560 CCATTCTGGCTGGGATAAAGTGG + Intronic
1040568468 8:48587613-48587635 ACAAGCTGCCTGGAATGCAGGGG + Intergenic
1041388868 8:57331483-57331505 ACATGCTGACTGACACAAAGTGG - Intergenic
1042022641 8:64385085-64385107 ACATCCTGGGTGGGATGAAGTGG - Intergenic
1042273978 8:66984372-66984394 TTATGCTGCATCGGATAAAGTGG - Intronic
1042772470 8:72394493-72394515 AGATGCTGCCTGGGATTTATAGG + Intergenic
1045055730 8:98366872-98366894 GCATGCTGCCTAGCATACAGTGG - Intergenic
1045813596 8:106253707-106253729 ATATGCATCCTGGGAAAAAGAGG - Intergenic
1047432857 8:124807655-124807677 ACATGGTGGAAGGGATAAAGGGG - Intergenic
1047476508 8:125237154-125237176 CCCTGCTGCCTGGGATCAAGAGG - Intronic
1047801897 8:128318782-128318804 CCACGCTGCCTGGGAAGAAGGGG + Intergenic
1048236752 8:132698519-132698541 ACAATGTGCCTGGTATAAAGAGG + Intronic
1049232616 8:141492356-141492378 ACCCGCTGCCTGGGACACAGAGG - Intergenic
1049472724 8:142783525-142783547 ACATGCTGCCTGTGACTAAATGG - Intergenic
1049745129 8:144260076-144260098 CCATGCTGCCTGGGACCCAGAGG - Intronic
1052333811 9:27299140-27299162 CCATTCTGGCTGGGATAAGGTGG + Intergenic
1053244237 9:36521443-36521465 ACATGAAACCTGGAATAAAGAGG - Intergenic
1053463727 9:38289950-38289972 GCATGCTGCCTGGGCTCCAGAGG - Intergenic
1054839311 9:69718676-69718698 ATATGCCGCCTGCGATAGAGAGG + Exonic
1055558361 9:77498593-77498615 ACATGATGCCTGGCACACAGTGG + Intronic
1058059100 9:100475928-100475950 ACATGCAGTGTGGGAAAAAGGGG + Intronic
1058234994 9:102478906-102478928 ATCTGATGCCTGGGAAAAAGGGG + Intergenic
1058574645 9:106387369-106387391 ACTTGCTGGCTGGGTGAAAGTGG + Intergenic
1060320775 9:122558460-122558482 AAATGCTTTCTGGGCTAAAGTGG + Intergenic
1061655434 9:132086505-132086527 ACATGATCCCAGGGACAAAGCGG + Intergenic
1061864183 9:133484023-133484045 ACTTGCTGCTGGGGAGAAAGAGG + Intergenic
1061902142 9:133678386-133678408 ACTTGCTGCAGGGGAGAAAGAGG - Intronic
1185488375 X:500087-500109 CCATTCTGCCTGGGATTAACAGG - Intergenic
1185613021 X:1403253-1403275 ACATGCTGCCTGGGCTTCAGGGG + Exonic
1185789795 X:2920039-2920061 ACATGCTGTCTGTTATAAAGAGG + Intronic
1186997184 X:15136144-15136166 CCATTCTGACTGGGATAAGGTGG - Intergenic
1187816097 X:23233492-23233514 ACATCCTTTCTGGGAGAAAGAGG - Intergenic
1188023673 X:25186313-25186335 AAATGGTGCCTGGCATATAGTGG + Intergenic
1188723200 X:33548374-33548396 ACATACTGAATGGGAAAAAGTGG - Intergenic
1189115981 X:38343105-38343127 ACATGTTTCCTGGGCTCAAGGGG + Intronic
1189126771 X:38456348-38456370 ACCTGCTGCTTGGGTTGAAGTGG - Intronic
1189492143 X:41478613-41478635 ACATGCAGCCTGGGTTACTGAGG + Intergenic
1189580635 X:42402805-42402827 AAATGCTTCCTGGACTAAAGTGG - Intergenic
1189607075 X:42690280-42690302 CCATTCTGGCTGGGATAAGGTGG + Intergenic
1189659779 X:43285243-43285265 ACATGCTGGCTGTGACAGAGAGG + Intergenic
1192151007 X:68712492-68712514 ACTTCCTGCCTGGGCTAAGGTGG + Intronic
1192569364 X:72190119-72190141 ACATGAAGCCTAGGAGAAAGTGG - Intronic
1194113940 X:89873160-89873182 AGATGCTGGCTGTGATGAAGAGG + Intergenic
1194589514 X:95781646-95781668 ACATCCTGGGTGGGAAAAAGTGG - Intergenic
1194695165 X:97038646-97038668 CCATTCTGACTGGGATAAGGTGG + Intronic
1194732300 X:97470035-97470057 ACATTCTGCCAGGCATTAAGTGG + Intronic
1195323259 X:103738104-103738126 ACATGATGCCTGACATAGAGGGG - Intergenic
1197260153 X:124308774-124308796 GCATGCTCCCTGTGAGAAAGAGG + Intronic
1197546345 X:127829476-127829498 ACATGTTGCCAGAGATAAATAGG - Intergenic
1197773225 X:130103793-130103815 ACAGGCAGCCTAGGATAAACTGG - Intronic
1198405115 X:136304684-136304706 GCATGCTGCCTGGCACATAGAGG - Intronic
1200466679 Y:3528516-3528538 AGATGCTGGCTGTGATGAAGAGG + Intergenic
1200974001 Y:9188044-9188066 AGAAGCTGACTGGAATAAAGGGG - Intergenic
1202136878 Y:21675582-21675604 AGAAGCTGACTGGAATAAAGGGG + Intergenic