ID: 1128869721

View in Genome Browser
Species Human (GRCh38)
Location 15:71144853-71144875
Sequence TCATTGCCCTGAATTTTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 187}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128869721_1128869726 18 Left 1128869721 15:71144853-71144875 CCATGTAAAATTCAGGGCAATGA 0: 1
1: 0
2: 0
3: 18
4: 187
Right 1128869726 15:71144894-71144916 GTGTAGGCTAATCCTTAATGAGG 0: 1
1: 0
2: 0
3: 4
4: 48
1128869721_1128869723 2 Left 1128869721 15:71144853-71144875 CCATGTAAAATTCAGGGCAATGA 0: 1
1: 0
2: 0
3: 18
4: 187
Right 1128869723 15:71144878-71144900 GTCCATGTGGACCAAAGTGTAGG 0: 1
1: 0
2: 1
3: 10
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128869721 Original CRISPR TCATTGCCCTGAATTTTACA TGG (reversed) Intronic
904514432 1:31043093-31043115 TCATTGTTTTGTATTTTACAAGG + Intronic
905962118 1:42051899-42051921 TCTTTGCCCTGAAGTTTAAAGGG - Intergenic
908418085 1:63932834-63932856 TCATTCCACTGATTTTTACCTGG + Intronic
908436311 1:64110182-64110204 TCATTGCTTTGAATATTAGAAGG - Intronic
911824183 1:102460834-102460856 ACAGTGCCCTGAATTGTACAAGG + Intergenic
913326384 1:117632018-117632040 TCTTTGTCCTGCATTTTACAGGG + Intergenic
917048212 1:170887335-170887357 TCTTTGCCCTGTATTATACTAGG + Intergenic
920868409 1:209772546-209772568 TCACTGGCCTACATTTTACAGGG + Intronic
920966406 1:210705004-210705026 TCCTTGGTCTGAATTTTCCAGGG + Intronic
923392221 1:233523746-233523768 TCACCACCCTGAATTTTACTGGG + Intergenic
923833714 1:237586363-237586385 TCAGTGAACTGAATTTTAAATGG - Intronic
1063399648 10:5730623-5730645 TCATTTCCAAGAATTGTACAAGG + Exonic
1063896038 10:10683301-10683323 ACAATGCCCTGGATTTTGCAGGG - Intergenic
1065022909 10:21515884-21515906 TCATTGTCCTGAATTTGCTACGG - Exonic
1066188168 10:33030774-33030796 TCCTTGCCCTGAATATTTCTGGG - Intergenic
1066206610 10:33195675-33195697 TCAATGCCCAGAATATTGCATGG - Intronic
1066500994 10:35994504-35994526 TGTTTGCCCTGACTTTTAAATGG - Intergenic
1067484692 10:46637178-46637200 TCATATTCCTGAATTTTAAAAGG + Intergenic
1067610066 10:47704471-47704493 TCATATTCCTGAATTTTAAAAGG - Intergenic
1068225707 10:54104345-54104367 TCAATGCCCTCACTTTAACAGGG + Intronic
1068617616 10:59137045-59137067 TCATAGCCCTGGATTCTACACGG - Intergenic
1068734398 10:60395800-60395822 TCCTTGCCCTCAAGTTTCCATGG + Intronic
1070505636 10:77110643-77110665 GCAATGCCCTGAATTTTAGCTGG - Intronic
1071468142 10:85959411-85959433 TCATTGCCCTGAACATCTCAAGG - Intronic
1071625648 10:87166091-87166113 TCATATTCCTGAATTTTAAAAGG - Intronic
1075339949 10:121638842-121638864 TCTTTCCCCTGAACTTTTCATGG + Intergenic
1078890251 11:15549229-15549251 ACATTTCCCTGATTTTTACCTGG + Intergenic
1080958073 11:37124603-37124625 TCATTGCCCAGATATTCACATGG + Intergenic
1086940511 11:92793046-92793068 TTAATGATCTGAATTTTACATGG - Intronic
1088412232 11:109547273-109547295 TTCTTGCACTGAATTTTACTTGG - Intergenic
1089160808 11:116435578-116435600 GCATAGCCCTGACTTTTTCAGGG + Intergenic
1099035627 12:77583987-77584009 TCATTGCTCTATTTTTTACATGG + Intergenic
1100023306 12:90097542-90097564 TCATTCTCCTGAAGTTTTCATGG + Intergenic
1101146993 12:101850403-101850425 TCATTCCCCAGAGTTTCACATGG - Intergenic
1102482424 12:113232984-113233006 TCATTCCCCTGGCTTTTTCAGGG + Intronic
1102824265 12:115934278-115934300 TCACTTCACTGAATTTCACATGG + Intergenic
1104313767 12:127678577-127678599 TTCTTGCCCTGAATTGTAGATGG + Intergenic
1105416202 13:20213858-20213880 TCTTTGCTCTGAAGTTTACATGG - Intergenic
1105836887 13:24220078-24220100 TCATTGCCTTGAATTCCTCATGG + Intronic
1106052941 13:26208340-26208362 TCAGTGCCCAAAATTTTACTGGG - Intronic
1108258895 13:48637604-48637626 TCATTTCCCTGGATTTCACGTGG - Intergenic
1108335620 13:49438544-49438566 TCAATGCCCTGAATTCTTGAAGG + Intronic
1108754843 13:53487240-53487262 TAATGGCCCTGAATTTTAAAGGG - Intergenic
1109829775 13:67771829-67771851 TCAAGGCCCTGAAAATTACATGG + Intergenic
1110125176 13:71933173-71933195 TCATTGCCCTCAATATTACCAGG - Intergenic
1110522859 13:76501368-76501390 TTATTTTCCTGTATTTTACAAGG + Intergenic
1110886260 13:80639995-80640017 TCTTTGCCATGAATTTTCCAAGG - Intergenic
1113315441 13:109174690-109174712 GTATGGCACTGAATTTTACATGG - Intronic
1114684538 14:24515912-24515934 CCATTTCCCTCAATTTTATAAGG + Intergenic
1115726749 14:36225750-36225772 CCATTGCACTGAACTTTCCAAGG - Intergenic
1116966252 14:51018141-51018163 TCTTTGTCATTAATTTTACAGGG + Intronic
1118707621 14:68494676-68494698 TCACTGCCCTCATTTTTATATGG - Intronic
1119185525 14:72639235-72639257 TCATTGCCAGGAACTGTACAAGG + Intronic
1119460687 14:74799992-74800014 TCAGTGCTCTGGATTTCACAGGG + Intronic
1120285922 14:82501570-82501592 TCATTGCTTTGATTTTTAAAAGG + Intergenic
1124817970 15:33015717-33015739 TCATTCCTCTGAATTATACTTGG + Intronic
1126309869 15:47303389-47303411 TCTTTCCCATGACTTTTACATGG + Intronic
1128869721 15:71144853-71144875 TCATTGCCCTGAATTTTACATGG - Intronic
1128905524 15:71464566-71464588 TTCTTGCCCTGAGTTTTTCATGG + Intronic
1129570610 15:76680345-76680367 TCTTTGCTCTGAAATTTACCTGG - Intronic
1129953133 15:79609523-79609545 TCTGTGCCCTGCATTTTTCATGG - Intergenic
1140292858 16:73679336-73679358 TCACTGGCCTGAAATATACAAGG - Intergenic
1142575087 17:901572-901594 TCATTGCCCTGGTTTTCACGGGG - Intronic
1144241433 17:13316462-13316484 TCATTGGCCAGAATGTTTCATGG + Intergenic
1148643559 17:49206028-49206050 TCATTGCCCTGAATGTCTCTCGG + Intronic
1150682183 17:67293042-67293064 TCATTGCCTTGAACTTCTCATGG - Intergenic
1152080332 17:78183313-78183335 TCATTCTTCTGAATTTTAAAAGG - Intronic
1153981658 18:10315554-10315576 CCATTGCTGTGAATTTCACAGGG - Intergenic
1157753145 18:50195451-50195473 ACATTGCCCTCGATTTTACCTGG + Intergenic
1158014617 18:52769126-52769148 TAATTGCATTGTATTTTACATGG + Intronic
1158658305 18:59360497-59360519 TCATTGCCCTGGACTCTCCATGG + Intergenic
1159680875 18:71350564-71350586 TCATTTTCCTTAGTTTTACAGGG - Intergenic
1164154827 19:22586902-22586924 TGATTTCCCTGGATTTTTCAAGG - Intergenic
1202636401 1_KI270706v1_random:48030-48052 TAATTGCCTTGTATTTTCCAGGG + Intergenic
926786543 2:16523758-16523780 GAATTGCCCTGACTTCTACAAGG + Intergenic
929248064 2:39723906-39723928 ACATTCCCCTGCATTTTCCAAGG + Intergenic
930763401 2:55060221-55060243 TCAATGCCCTGGACTTTAAAAGG + Intronic
935368738 2:102322326-102322348 CCATTGCCCTTAATCTTATATGG + Intronic
937522122 2:122724523-122724545 TCATTTCCCTGAATTGTTCACGG - Intergenic
938282218 2:130072438-130072460 TAATTGCCTTGTATTTTCCACGG + Intergenic
938332845 2:130461010-130461032 TAATTGCCTTGTATTTTCCAGGG + Exonic
938356962 2:130659661-130659683 TAATTGCCTTGTATTTTCCAGGG - Intergenic
938420751 2:131144427-131144449 TCATTGCACTGCAGTTTCCAGGG + Intronic
938433398 2:131266467-131266489 TAATTGCCTTGTATTTTCCAGGG - Intronic
938919692 2:135984322-135984344 TAATTGCCCTAGTTTTTACAAGG + Intronic
939052467 2:137324481-137324503 TCATTGCTTTGAATTTTACTAGG + Intronic
939419018 2:141941886-141941908 TCTTTGCTCTGAATCTTATACGG - Intronic
940187201 2:150999130-150999152 TCATTACTCTGAATTATAAATGG - Intergenic
941310162 2:163918291-163918313 TCATTGCCCTCAGTTTCAAAAGG + Intergenic
941363449 2:164581337-164581359 AGATTACCCTGAATTATACAGGG + Intronic
942782677 2:179663942-179663964 TCAATTCTCTGGATTTTACAAGG - Intronic
944078174 2:195755803-195755825 TCATTGCCCAGAACTTTTCTAGG - Intronic
944776615 2:202973466-202973488 TGATGGGCTTGAATTTTACACGG - Intronic
946058986 2:216925648-216925670 TCATGACCTTGAATTTGACAGGG - Intergenic
946768926 2:223067986-223068008 TTAATGCTCTGAATTTTACTTGG + Intronic
947991171 2:234488788-234488810 TCAATGCCCAGAATCTCACAAGG + Intergenic
948047281 2:234953572-234953594 TCATTACCTTCATTTTTACAAGG - Intronic
948423435 2:237874249-237874271 AGATTGACCTGAATTTGACAGGG + Intronic
1170150717 20:13222659-13222681 TCCTTGCCCTGAAGTTGAAATGG - Intronic
1175342139 20:58239560-58239582 TTATTGGCCTGAATTTTATGTGG - Intergenic
1176107386 20:63395818-63395840 TCCTTGCCCTGAAGTCTGCATGG - Intergenic
1177342428 21:19822136-19822158 TCTTTGCTCTGAATTTGACCAGG - Intergenic
1178389231 21:32185034-32185056 GCATTTCCCAGAATTTTCCATGG + Intergenic
1178730926 21:35101866-35101888 TCAGAGCCCTGAAATTTCCATGG + Intronic
1179717540 21:43297611-43297633 TCATTGACCTGCATGTTACGAGG + Intergenic
951077683 3:18416266-18416288 TCATTGACCTGCCTTTTAGAGGG - Intronic
954840061 3:53503608-53503630 TCAGTGCCCTGAATTTCCCTGGG - Intronic
955043522 3:55338664-55338686 TCCTTCCCCTGAGTTTTACTCGG - Intergenic
955094819 3:55786966-55786988 TCCTTGCCCTGAAATATATATGG + Intronic
955281458 3:57598204-57598226 TCATTGCTGTGAATTTTAAAAGG - Intronic
956966476 3:74467396-74467418 TCATTACTCTGAAAATTACAGGG + Intronic
957839451 3:85648814-85648836 TCATTTCCATGAATATTACATGG - Intronic
958667115 3:97155577-97155599 TCATTGTTCTGAGTTTTATAAGG + Intronic
962326654 3:134440198-134440220 TCTTTGACCTGTATTGTACAGGG + Intergenic
963291814 3:143497996-143498018 TCTTTGCGCTACATTTTACATGG + Intronic
964594189 3:158404104-158404126 TCAAGGCCATGAATTTTTCAGGG + Intronic
964633505 3:158837296-158837318 TTATTGCCTTGAAGTTGACATGG - Intergenic
964766508 3:160184160-160184182 TCGTTGTCCTGAATTTTCCCAGG + Intergenic
968770672 4:2504128-2504150 TCATTTCCCTTCATTTTTCAGGG - Intronic
969241869 4:5904239-5904261 TCACAGCCCTGCAGTTTACAGGG + Intronic
970924168 4:21431238-21431260 ACTTTTCCCTGAATTTTTCATGG - Intronic
971473411 4:27050670-27050692 TAAATGCCCTGAATCTTAGATGG + Intergenic
971894754 4:32578389-32578411 TCAATGCCCAGAATTGTAAAAGG + Intergenic
973965479 4:56157762-56157784 TCCTGGCCCTGAATTTTAAAAGG - Intergenic
974178182 4:58351642-58351664 TTATTCCTCTGGATTTTACAAGG - Intergenic
976860677 4:89662316-89662338 TCATTGGCTGGAATTATACATGG - Intergenic
978035238 4:103985021-103985043 TCCTTGCCTTAAATTTTACAAGG - Intergenic
978313076 4:107407621-107407643 CAATTGCCCTGGATTTTACCTGG + Intergenic
979801613 4:124916218-124916240 TCATTGTCCTGAAGTTTGCTTGG + Intergenic
980832205 4:138144581-138144603 CCATTACCCTGAGTTCTACAGGG + Intergenic
981580068 4:146242226-146242248 AGCTTGCCCTAAATTTTACATGG - Intergenic
982058034 4:151572974-151572996 TAATTGGCCTGAATTTCAAATGG - Intronic
985771224 5:1812716-1812738 TCATTGCCCTGAGTTAATCATGG + Intronic
986383622 5:7209632-7209654 TGATTGTACTCAATTTTACAGGG + Intergenic
989012885 5:36893650-36893672 TCTTCCTCCTGAATTTTACATGG + Intronic
990274952 5:54185306-54185328 TCATTGAGCTGAATTTTGAAGGG - Intronic
990854384 5:60247607-60247629 ACATTACACTGAACTTTACATGG + Intronic
991626393 5:68605603-68605625 TCATTGCCTTGAATGTGAAAGGG - Intergenic
992556921 5:77913018-77913040 GCATAGCACTGAATTTTAAAGGG + Intergenic
994601845 5:101915340-101915362 CCATTGTACTGAATTTTACATGG - Intergenic
994655644 5:102590323-102590345 CCATTGCCCTGTTTTTTATAAGG - Intergenic
996478921 5:123951254-123951276 TCATTCCCCTGAAATTTAATTGG + Intergenic
1000200086 5:159000097-159000119 TGATTGCCATGATTTTCACAAGG - Intronic
1001160972 5:169312617-169312639 CCAATGCCCTAAATATTACAAGG - Intergenic
1002522701 5:179800374-179800396 GCAGTGCCCTGAATTCTCCATGG - Intronic
1003154800 6:3582846-3582868 TGTTTGCCCTTGATTTTACAGGG + Intergenic
1003217106 6:4124108-4124130 TCATTGACCTGCTTTTAACAGGG - Intronic
1007975921 6:46101026-46101048 TCAATCCCCTGAAGTTTCCACGG - Intergenic
1009426760 6:63522765-63522787 CCATTGCACTGAATCTTCCATGG - Intronic
1009815575 6:68729539-68729561 TCCATAGCCTGAATTTTACATGG + Intronic
1009861043 6:69332647-69332669 TCAATTGCCTGAATTTTAAATGG - Intronic
1013635118 6:112021859-112021881 TCATTGCCCTGAGTTATACTAGG + Intergenic
1014617470 6:123621061-123621083 TCATTGCCAAGCATTTTACTTGG - Intronic
1016578164 6:145595286-145595308 TCATTGTTCTGAAGTTTGCATGG - Intronic
1018130013 6:160720740-160720762 TAATGGCTATGAATTTTACAAGG - Intronic
1018864962 6:167739150-167739172 TCATTGTCCTAATTTTTATATGG - Intergenic
1020820733 7:12964149-12964171 ACATTTCCCCAAATTTTACAGGG + Intergenic
1021380830 7:19963935-19963957 TCCTTCCCCTAAATTTCACATGG - Intergenic
1021739366 7:23670221-23670243 TGCTTGTCCTGAATTTGACAGGG + Intergenic
1022068881 7:26890346-26890368 TTATTACCCTGAATTTTAATAGG + Intronic
1022181143 7:27921701-27921723 TCAGAGCCCTGTATTTTTCATGG - Intronic
1024966288 7:55024892-55024914 TCTTTGCCTTTAATTCTACATGG + Intronic
1025029285 7:55543419-55543441 TCATTGCCAGGTATTTTAAATGG - Intronic
1027462574 7:78473569-78473591 TGTTTGCACTGAGTTTTACAGGG - Intronic
1027867933 7:83672404-83672426 TGGTTTCCCTGAATCTTACAGGG - Intergenic
1028205621 7:88013323-88013345 TCATTACCCTCATTTTCACAAGG - Intronic
1029918299 7:104235134-104235156 TTGTTGCTCTGAATTTTATAAGG + Intergenic
1030354128 7:108524425-108524447 TCAGTGTCCTGATTTTTTCAGGG - Intronic
1030831938 7:114234761-114234783 TTCTTGCCCTGCATTTTCCATGG + Intronic
1032609143 7:133392345-133392367 TCATTGCCCTGAGGTTGACCTGG + Intronic
1032949265 7:136888630-136888652 TGATTCCCCTTAATTTAACATGG + Intronic
1034562063 7:151886822-151886844 TCCCTCCCCTGAATGTTACAGGG - Intergenic
1037384858 8:18327464-18327486 TCAGTGCTCTGAAATTTAGAGGG + Intergenic
1038683798 8:29696293-29696315 TTAATACTCTGAATTTTACACGG + Intergenic
1039146589 8:34453876-34453898 ACATTCCACTGAAATTTACATGG + Intergenic
1039166186 8:34682622-34682644 TCATGGCCCTGAATGATGCAAGG - Intergenic
1040365672 8:46712544-46712566 TCAGTGCCCTGAATTGCAAAAGG - Intergenic
1042105379 8:65320796-65320818 TCAATGCCCAAAATCTTACATGG + Intergenic
1042186333 8:66139895-66139917 TCATTGACCAAAATGTTACATGG - Intronic
1042289260 8:67151067-67151089 TCATAGCCCTGCATCTTTCAAGG + Intronic
1044212808 8:89570347-89570369 TCATTGCTTTCAATTTTTCAGGG - Intergenic
1044514735 8:93124935-93124957 ACATTTCCCTGAATTATAAATGG - Intergenic
1045444335 8:102244317-102244339 TCATTGACCAAAATGTTACATGG - Intergenic
1046297484 8:112240352-112240374 TCAATGCCCCAAATTTTCCAAGG - Intronic
1046534772 8:115494988-115495010 TCCTGACCCTGAATTTTACCTGG + Intronic
1046891523 8:119427082-119427104 TTATTGACCTTATTTTTACATGG + Intergenic
1046903889 8:119552019-119552041 TCTTTGCCATGTATTTTTCAGGG + Intergenic
1047684453 8:127290475-127290497 TCTATGCCCTAAGTTTTACAGGG - Intergenic
1048525494 8:135198565-135198587 TCATTGCACAGGATTTTACTGGG + Intergenic
1054917079 9:70504731-70504753 TCAATGCCCTGCTTTTTGCATGG + Intergenic
1055001115 9:71449821-71449843 TCTTTGATCTGAAGTTTACATGG + Intergenic
1055464591 9:76551724-76551746 TAAGTCCCCTGAATTTTCCAGGG - Intergenic
1055519499 9:77065906-77065928 TCATGTCCCTGAATTATTCAAGG + Intergenic
1056135692 9:83627742-83627764 TGAGTGTCCTGAACTTTACATGG + Intronic
1056433232 9:86549366-86549388 TCATACCCATGAATTTTTCAGGG + Intergenic
1058623408 9:106907494-106907516 ATATTGCCATGAGTTTTACATGG + Intronic
1059081170 9:111252179-111252201 ACATTCCCCTGGATTTTACATGG - Intergenic
1060609191 9:124946122-124946144 TCAGTTCCATGAATTTTAAATGG + Intronic
1060676202 9:125517364-125517386 TGCTTGCCCTGATTTTTCCAGGG + Intronic
1186705991 X:12139303-12139325 TCTTAGCCCTGAATTATACATGG - Intronic
1187851823 X:23598599-23598621 CCATTGTCCTGCATTTTAGAGGG + Intergenic
1189890263 X:45593616-45593638 TCTTTGCTCTGAAGTTTACTTGG + Intergenic
1192558894 X:72112064-72112086 TCTTTTCCCTGATTTTCACATGG - Intergenic
1194099968 X:89692018-89692040 TCATTGCCCTTAATTTTTATTGG + Intergenic
1199102935 X:143826767-143826789 TAATTGCCGTGAATTTTAATAGG - Intergenic
1200452969 Y:3353375-3353397 TCATTGCCCTTAATTTTTATTGG + Intergenic