ID: 1128869723

View in Genome Browser
Species Human (GRCh38)
Location 15:71144878-71144900
Sequence GTCCATGTGGACCAAAGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128869721_1128869723 2 Left 1128869721 15:71144853-71144875 CCATGTAAAATTCAGGGCAATGA 0: 1
1: 0
2: 0
3: 18
4: 187
Right 1128869723 15:71144878-71144900 GTCCATGTGGACCAAAGTGTAGG 0: 1
1: 0
2: 1
3: 10
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128869723 Original CRISPR GTCCATGTGGACCAAAGTGT AGG Intronic
904332521 1:29769831-29769853 GTCCATGTGAACCCAAGATTTGG + Intergenic
905200751 1:36314935-36314957 ATCCATGTGGACCAAGCTGAGGG + Intronic
905450085 1:38050750-38050772 AACCATGTGGACCAAACTCTGGG - Intergenic
906696614 1:47827696-47827718 CTCATTGTGGGCCAAAGTGTTGG - Intronic
907214908 1:52854478-52854500 GCAGATGTTGACCAAAGTGTAGG - Exonic
910060918 1:83090566-83090588 GTCCCTTTAGAGCAAAGTGTGGG - Intergenic
911053914 1:93694948-93694970 GCCCAGGTGGGCCAGAGTGTAGG - Intronic
1064881336 10:20057774-20057796 TTCCATGTGGGCTAAACTGTAGG + Intronic
1074893831 10:117757668-117757690 ATGCATTTGGTCCAAAGTGTGGG + Intergenic
1078437060 11:11334064-11334086 GAGCATATGGACCACAGTGTCGG - Intronic
1082707562 11:56511317-56511339 CTCACTGTGGACCAAAGTGTTGG + Intergenic
1083109855 11:60395128-60395150 GCCCATGTGGTACAAAGTGCAGG - Intronic
1084347556 11:68565398-68565420 TTGGATGTGGACCATAGTGTTGG + Intronic
1087492135 11:98841926-98841948 GTCCATTTGGTCTATAGTGTAGG + Intergenic
1088490042 11:110378099-110378121 GCCCACTTGGACCAAAGTGCTGG + Intergenic
1088900627 11:114114194-114114216 GTCCATGTCGGCCACAATGTTGG + Intronic
1089598753 11:119599925-119599947 GTGCATGTGAACAGAAGTGTGGG + Intergenic
1091609729 12:1995671-1995693 GCCCATTTGGGGCAAAGTGTGGG - Intronic
1093934389 12:24985237-24985259 GGCCATATGGATCAAATTGTTGG - Intergenic
1106118633 13:26838711-26838733 GTCCCTGCGGACGGAAGTGTTGG + Intergenic
1107366323 13:39681578-39681600 GTCCTTGTGTACCAAAGGTTGGG + Intronic
1117778237 14:59204362-59204384 GGCCATGTGGAACAGAATGTGGG - Intronic
1122559857 14:102605144-102605166 TTCCATGTGGCCCCAGGTGTTGG + Intronic
1123054976 14:105565048-105565070 GCCCTTGTGGACCTGAGTGTGGG + Intergenic
1123079418 14:105684627-105684649 GCCCTTGTGGACCTGAGTGTGGG + Intergenic
1127196699 15:56593875-56593897 GTCCATTTGGTCTAAAGTGCAGG - Intergenic
1128869723 15:71144878-71144900 GTCCATGTGGACCAAAGTGTAGG + Intronic
1133004319 16:2869852-2869874 GTCAGTGTGGAACAAAGTCTTGG - Intergenic
1133763527 16:8819259-8819281 GTCCATGTGGACCCATCTCTAGG + Intronic
1137923487 16:52516090-52516112 GTTCATCTGGTCCAAAGTGTTGG + Intronic
1141473854 16:84258701-84258723 GTCTGTGTGGACCAAAGGGAGGG - Intergenic
1144614319 17:16754737-16754759 GTCCATGTGGTCTATAGTGCAGG + Intronic
1144898388 17:18560940-18560962 GTCCATGTGGTCTATAGTGCAGG - Intergenic
1145133987 17:20384781-20384803 GTCCATGTGGTCTATAGTGCAGG + Intergenic
1151991354 17:77576891-77576913 GTCCATGTGAAGGAAACTGTGGG - Intergenic
1155950431 18:31905379-31905401 GTCCATATGCACCAAAGTGTAGG - Intronic
1159028869 18:63210862-63210884 GTGAATGGGGTCCAAAGTGTGGG - Intronic
1159594444 18:70369549-70369571 CAGCCTGTGGACCAAAGTGTGGG + Intergenic
1159718187 18:71851137-71851159 GCCCATGTGGAGCACAGTGTGGG - Intergenic
1163731687 19:18953421-18953443 GTCAATGGGGACCAGAGTCTGGG + Intergenic
1164159770 19:22618550-22618572 AGCCATGTGGACCAAAATGCAGG - Intergenic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1166364893 19:42273358-42273380 GTCCATGCGAACCAAAGAGATGG + Intronic
926702646 2:15813961-15813983 GTGCATGAGGAGCAAAGGGTGGG - Intergenic
927851954 2:26504865-26504887 GTCCAGGTGGAGCCAGGTGTAGG + Intronic
928009794 2:27596437-27596459 GTCCCTGTGGACCAGAGTTGGGG - Intronic
932207200 2:69893748-69893770 GTGCATGTGGACAAAAATGGGGG + Exonic
938809989 2:134843994-134844016 GCCCATGTGGAGCAGAGTCTTGG - Intronic
943139510 2:183963052-183963074 TTCCATGTGCACCTAAGTATGGG + Intergenic
948255231 2:236563652-236563674 GTCAATTTTGACCAAAGTGGAGG - Intergenic
948305816 2:236945987-236946009 ATCCATGTGGACCGAAGTGCAGG + Intergenic
1168995913 20:2133154-2133176 GTCCATGTGGACCTCTCTGTGGG + Intronic
1170417940 20:16164356-16164378 GTCCCTGGGGCCAAAAGTGTTGG - Intergenic
1170774673 20:19364986-19365008 CTCCATGTGGACCACAGAGAGGG + Intronic
1171477082 20:25419170-25419192 GTCCATGTGGAGCACAGCATAGG + Intronic
1172770182 20:37377643-37377665 GGCCATGTGGACCCAGGTGATGG + Intronic
1173180044 20:40799399-40799421 GTCCATGAAGTCCAAAATGTTGG + Intergenic
1173218503 20:41111141-41111163 GTCCATGTGCACTAGAGTGAGGG + Intronic
1173493641 20:43503430-43503452 GTCCATGTGGCCCTGAGAGTTGG - Intergenic
1177011296 21:15733047-15733069 CTTCATGTTTACCAAAGTGTAGG + Intronic
1182662051 22:31932102-31932124 GTCCATGTGGAAGAGAGTGGAGG + Intergenic
1182694709 22:32189863-32189885 GGCCATGTCTACCAAACTGTTGG - Intergenic
1184499186 22:44861663-44861685 GGCCATGTGGACCAACGTGAGGG - Intronic
1184971561 22:48025770-48025792 GTCCCTGAGGACCAGAGTGCAGG + Intergenic
949648981 3:6132876-6132898 CTCAATGTGTACCAAAGTGATGG - Intergenic
950624924 3:14238284-14238306 GTCCATGATGCCCAAAATGTTGG - Intergenic
953304692 3:41817129-41817151 GTTCATTTGGACCACTGTGTAGG - Intronic
955953271 3:64263402-64263424 GTCCATGTGCCCCAAAGACTAGG + Intronic
959497373 3:107067224-107067246 GTCCATGTGGGTGGAAGTGTTGG + Intergenic
961029078 3:123586160-123586182 GTCCCTGTTGACCAAAAGGTTGG - Intergenic
961502551 3:127347601-127347623 GTCCATGAGGAGCAAAGGGCAGG + Intergenic
966585415 3:181618539-181618561 GTCCCTGTGGAACAAAGCTTGGG - Intergenic
968179529 3:196581652-196581674 ATCCAAGTGGTCCTAAGTGTTGG - Intronic
973086686 4:46071672-46071694 GACCATGTAGACTAATGTGTAGG + Intronic
974043766 4:56880097-56880119 GTGAATGAGAACCAAAGTGTAGG + Intergenic
977446011 4:97133450-97133472 GTTCTTTTGGAGCAAAGTGTAGG - Intergenic
977534055 4:98236459-98236481 GGCAATGTGGAACAGAGTGTTGG - Intergenic
992153173 5:73926495-73926517 GTGCAGGTGAACCAAAGGGTAGG - Intronic
992364456 5:76077792-76077814 GTCCATGTGGATCTGGGTGTAGG + Intergenic
996392458 5:122976247-122976269 GTCCGTGAAGACCAAAATGTGGG + Intronic
1000821506 5:165990286-165990308 GTGCATGTAGACCAAAGTGGGGG - Intergenic
1003094600 6:3132383-3132405 CCCCATGTGGGCCACAGTGTTGG + Intronic
1003399288 6:5778718-5778740 GGCCATGTGGCCCCAACTGTTGG + Intergenic
1004328617 6:14700639-14700661 GTACATGAGGAGCAAAGGGTTGG + Intergenic
1008687035 6:53936817-53936839 GATCATGTGAACCACAGTGTTGG + Intronic
1011741616 6:90366466-90366488 GGAAATGTGGACCAAAATGTAGG - Intergenic
1013852086 6:114528196-114528218 TTGCATGTGGACCAAAGTAAGGG - Intergenic
1016838088 6:148499391-148499413 GAGCATTTGAACCAAAGTGTAGG + Intronic
1026782415 7:73277839-73277861 GTCCATGTGTACCCAAGGTTTGG - Intergenic
1027023177 7:74830660-74830682 GTCCATGTGTACCCAAGGTTTGG - Intronic
1030551264 7:110963394-110963416 GTCCATGAGGGCCAAAGTTTTGG - Intronic
1035942770 8:3921895-3921917 GTCCATCTGGTCCATACTGTTGG + Intronic
1037252636 8:16914791-16914813 GTCCTTGTGGACCTCAGGGTTGG - Intergenic
1041903040 8:63002818-63002840 GTCTATATGGAGCCAAGTGTCGG + Intergenic
1045884933 8:107084447-107084469 GTGGATGTGGGCCAGAGTGTAGG + Intergenic
1047109165 8:121769375-121769397 GTTCATGTTGACCAAAATGTTGG - Intergenic
1048131004 8:131697422-131697444 TTCTATGGGGACCAAAATGTAGG - Intergenic
1056144935 9:83720152-83720174 GCCCATGTGGACCAAAATGGGGG - Intergenic
1059100956 9:111470881-111470903 GGCCTTGTGGACCTCAGTGTTGG - Intronic
1060482699 9:124026514-124026536 GGGCATGTGGAGCAAGGTGTGGG + Intronic
1187359372 X:18610366-18610388 GTCCATCTGGAACAAACTGTGGG - Intronic
1189546057 X:42043724-42043746 GACCATGTGGCCCAAGTTGTTGG + Intergenic
1189663736 X:43331089-43331111 GTACAGGTGGTCTAAAGTGTGGG - Intergenic
1190157558 X:48006097-48006119 GTGGATGTGGGCCAAAGTGAGGG + Intronic
1190173328 X:48128982-48129004 GTGGATGTGGGCCAAAGTGAGGG + Intergenic
1190732449 X:53234614-53234636 GGCCATGTGGAGCAAACTGAGGG + Exonic
1193927068 X:87500487-87500509 GTCCATGTTCAACATAGTGTTGG - Intergenic