ID: 1128872454

View in Genome Browser
Species Human (GRCh38)
Location 15:71171983-71172005
Sequence GCTTCATTTTGTCACTTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 231}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128872454_1128872455 12 Left 1128872454 15:71171983-71172005 CCATCAAAGTGACAAAATGAAGC 0: 1
1: 0
2: 1
3: 23
4: 231
Right 1128872455 15:71172018-71172040 ATGCCAAAAATGAAATAAAATGG 0: 1
1: 0
2: 9
3: 128
4: 1364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128872454 Original CRISPR GCTTCATTTTGTCACTTTGA TGG (reversed) Intronic
901081113 1:6584753-6584775 GCTTCATGAAGTCATTTTGATGG + Intronic
903082712 1:20824142-20824164 AATTCTTTTTGTCCCTTTGAAGG + Intronic
903250432 1:22049362-22049384 GCTTCATTTTTTAAACTTGAGGG - Intergenic
904294779 1:29512769-29512791 TCATCATTTTGCCAGTTTGAGGG - Intergenic
909059831 1:70867357-70867379 GTTTAATATTCTCACTTTGAGGG + Intronic
909426520 1:75531733-75531755 CTTTCATTATGTCACTTTGCTGG + Intronic
909785065 1:79600869-79600891 GCTTCATTTTGTTCCTTTTGTGG - Intergenic
910157720 1:84239062-84239084 GCTTCATTTTATCATTATCAGGG + Intergenic
911843983 1:102725037-102725059 GATACATTTTGTTACTTTGTTGG - Intergenic
914718371 1:150269244-150269266 GTTTCCTTTCGTCACTTTGTGGG + Intronic
919149385 1:193676139-193676161 GCCTCTTTATGTCACTTTGTGGG + Intergenic
921105297 1:211971008-211971030 GTTTCTTTTTGTCACAGTGATGG - Intronic
921569539 1:216762083-216762105 GCTTCATTTTGCCTATTTGAAGG - Intronic
923859454 1:237878382-237878404 GATTCTTTTTGTCACTTTCCAGG - Exonic
1063513772 10:6673269-6673291 GTTTTATTTTCTCCCTTTGATGG - Intergenic
1067256930 10:44650489-44650511 TCTTTATATTGTCACTGTGAGGG + Intergenic
1068542207 10:58307536-58307558 GCTTCAGTTTTTCACATTAAAGG - Intergenic
1068588220 10:58824730-58824752 GCTTAAAGTTGTCTCTTTGAGGG - Intronic
1069643428 10:69972075-69972097 GCTTCATTTTTTTCATTTGATGG - Intergenic
1070471204 10:76781414-76781436 GCTTCTTCTTTTCACTTTTAAGG + Intergenic
1072885927 10:99273848-99273870 GCTTCTTTTTGTCTCTGTCATGG - Intergenic
1073662115 10:105488097-105488119 TTTTCATTTTGTCAATTTTAAGG - Intergenic
1074171852 10:110947511-110947533 GCTTTATTTTGTTCCTTTGATGG - Intronic
1074467170 10:113693771-113693793 GCTTTATTTTGTTCCTTTGGTGG + Intronic
1074925375 10:118063754-118063776 GATTTATTTTGTCACAGTGAAGG - Intergenic
1075903820 10:126063911-126063933 GCTTCATTTTGGAGCTTTGGTGG + Intronic
1078188429 11:9072150-9072172 CCTTCTTTTAATCACTTTGAAGG + Intronic
1078302565 11:10147482-10147504 ACTGCATGTTCTCACTTTGAGGG + Intronic
1079786072 11:24674422-24674444 TTTTCATTTTGTCACTTTACTGG + Intronic
1080228669 11:29990455-29990477 GGCCCATTTTGCCACTTTGATGG - Intergenic
1080494668 11:32805164-32805186 GCCTCATTTTTTCACTCTTAAGG - Intergenic
1084410737 11:69004714-69004736 GAGTCATTTGGTGACTTTGATGG - Exonic
1087689913 11:101308741-101308763 GCTTCCTTTTTTCACTTTTAAGG + Intergenic
1087758472 11:102079919-102079941 GCATTATTTTGTCAATTTTATGG - Intronic
1087847486 11:102989855-102989877 GCTGCATTTTGTCCCTATGGAGG - Intergenic
1087869905 11:103279974-103279996 TCTTCAGTTTGTCACTGTGTAGG - Intronic
1089099633 11:115951899-115951921 GCTTTATTTTGTTTCTTTGGTGG + Intergenic
1089744978 11:120610338-120610360 TCTTCATTATGCCACTGTGAAGG - Intronic
1090104666 11:123839776-123839798 CCTTCTTTTTGTCACTTAGCAGG + Intergenic
1091517985 12:1204978-1205000 GTTTCATTTTGTGACTCTGCTGG + Intronic
1093481589 12:19609418-19609440 GCTTCATTTTGTAAGTTTCTGGG + Intronic
1093748800 12:22774539-22774561 GCTTTTTTTTTTCATTTTGAAGG - Intergenic
1094323684 12:29213173-29213195 GCTGAACTTTGTCACTTTGAAGG - Intronic
1095592537 12:43919991-43920013 TCTTCATTCTGTTACTTTAATGG + Intronic
1098237861 12:68435180-68435202 GCTTCAGTTTGTCACCATGTGGG - Intergenic
1099318629 12:81116922-81116944 AGTTCATTTTCTGACTTTGAAGG + Intronic
1100044262 12:90359171-90359193 GCTACATTCTGTCAGTTAGAAGG - Intergenic
1100681207 12:96923517-96923539 TCTTATTTTTGCCACTTTGATGG + Intronic
1100780029 12:98014044-98014066 ACTTAATTTTGTTCCTTTGATGG - Intergenic
1100911538 12:99369125-99369147 GCTAAATTTTATCACTTTTAGGG - Intronic
1101200987 12:102436140-102436162 AGTTCAGTTTGTTACTTTGAAGG - Intronic
1102906869 12:116683214-116683236 GCTTAATTTTTTGGCTTTGAGGG - Intergenic
1103059638 12:117848159-117848181 TCTTCTTTTTGGCATTTTGATGG - Intronic
1104806743 12:131594283-131594305 GCTTCCGTTTGTCAATTTCATGG - Intergenic
1105777397 13:23676506-23676528 TCTTCATTTTTTCCCTTTTATGG + Intergenic
1107024092 13:35782037-35782059 GCCTCCTTTTGCCATTTTGATGG - Intronic
1107169634 13:37325214-37325236 TCATCCTTTTGTCAATTTGATGG - Intergenic
1107745338 13:43499722-43499744 GCTTTATTTTGTCTTTTTGGTGG - Intronic
1107930736 13:45305280-45305302 GCTTCATTTTGTAACAATGCTGG + Intergenic
1109785681 13:67171790-67171812 GCTACATTTTCCCACTTTGTAGG - Intronic
1112330352 13:98472629-98472651 GCTTGATTTTCTTCCTTTGAAGG + Intronic
1114297231 14:21340918-21340940 GTTTTTTTTTGACACTTTGATGG - Intronic
1114653786 14:24303776-24303798 GCCTCTCTTTGCCACTTTGATGG + Exonic
1115989497 14:39137765-39137787 GCTTCATTTTCCCACTTTCCTGG - Intergenic
1117747910 14:58890384-58890406 GCTCCATTTTAACACTTTGTTGG - Intergenic
1118552640 14:66972566-66972588 GCCCCATTTTGTCACATTCAAGG + Intronic
1119244148 14:73089220-73089242 GCTTCATTTTGTGAGTTTTTTGG - Intronic
1121640931 14:95484367-95484389 GCTCCAATTGGACACTTTGAAGG + Intergenic
1123047439 14:105526007-105526029 GCTTCATTTTGTCACTGAGGTGG - Intergenic
1126492336 15:49251711-49251733 GCTTCATTTCTTAACCTTGATGG + Intronic
1127053027 15:55104467-55104489 GCTTCATTTTGGCACGATTAAGG + Intergenic
1128872454 15:71171983-71172005 GCTTCATTTTGTCACTTTGATGG - Intronic
1130065284 15:80597623-80597645 CCTCCATTTTGCCACTTTCAAGG - Exonic
1130410311 15:83642328-83642350 GCTTTATTTTGTTCCTTTGGTGG + Intergenic
1131627924 15:94143497-94143519 TCATTATTTTGTTACTTTGATGG + Intergenic
1135606562 16:23831108-23831130 GGTTTATTTTTTCCCTTTGAAGG + Intergenic
1136982706 16:35072779-35072801 GCATCATATTGTGACTCTGAGGG + Intergenic
1139078708 16:63487323-63487345 GCTCACTTTTGTCACTTGGATGG + Intergenic
1140657631 16:77156825-77156847 GTTTCTTTTTCTCATTTTGACGG - Intergenic
1143061702 17:4207246-4207268 GGTTCCCTTTTTCACTTTGAAGG - Intronic
1144491856 17:15719684-15719706 GTTTCATTATATGACTTTGATGG + Exonic
1144908624 17:18659520-18659542 GTTTCATTATATGACTTTGATGG - Exonic
1146491073 17:33282830-33282852 ACCTCCTTTTGTCACTTTTAAGG + Intronic
1147284864 17:39394143-39394165 GCTAAATTTGGTCACTTTAAGGG + Intronic
1150000735 17:61437764-61437786 GCTTTATTTTGTTCCTTTGGTGG + Intergenic
1152213587 17:79018659-79018681 GCTTAATTTTGCCAATCTGATGG + Intergenic
1159524716 18:69573249-69573271 GCTTCATTTTCACACATTGGAGG - Intronic
1162207475 19:9066550-9066572 GCTTCAACTTGTGAATTTGAGGG - Intergenic
1163328016 19:16617796-16617818 ATTTCATTTTCTCACCTTGATGG - Intronic
927331117 2:21865572-21865594 GCTTTATTTTGTTCCTTTGATGG - Intergenic
928466047 2:31523417-31523439 ATCTCATTTTGTCCCTTTGAGGG - Exonic
928523970 2:32120772-32120794 GATTTATTTTCTCATTTTGATGG + Intronic
930451978 2:51552909-51552931 GCTTCCTTTTGGCAGTTTCACGG + Intergenic
932959379 2:76395140-76395162 GCTTGATTTTCTCATCTTGATGG - Intergenic
933314575 2:80700745-80700767 GCTTTATTTTCTCTCTTTGCTGG + Intergenic
937909588 2:127068944-127068966 CCTTCTTTTTGGCAGTTTGAAGG + Exonic
938615944 2:132998705-132998727 GCTTCATTTTATTATTTCGACGG + Intronic
939781473 2:146455504-146455526 TCTTCATACTGTCACATTGAGGG - Intergenic
940469771 2:154081455-154081477 TCTTCATACTGTCACATTGAGGG - Intronic
940711401 2:157166881-157166903 GGTTAATATTGTCACCTTGATGG + Intergenic
942604963 2:177680596-177680618 ACTTCATTTTCTAATTTTGATGG + Intronic
943126688 2:183803413-183803435 GCTTTATTTTGTTACTTTGGTGG + Intergenic
943289810 2:186054972-186054994 GGTTAATTTTCTGACTTTGAAGG + Intergenic
943513242 2:188852545-188852567 TCTGTATTTTGTCCCTTTGATGG + Intergenic
945634359 2:212329114-212329136 ATTTCATTTTTTCACTTTAAAGG + Intronic
946448208 2:219757784-219757806 GCTTTGCTTTTTCACTTTGAAGG - Intergenic
1170383533 20:15789195-15789217 ACTTCTTTTTGTCATTTTAAGGG - Intronic
1170482266 20:16777909-16777931 ACTTCATTATGTTATTTTGAAGG - Intergenic
1170957399 20:20993818-20993840 GCTTCATTTTGAGCCTTTGGTGG + Intergenic
1171095094 20:22325236-22325258 CATTGATTTTGTAACTTTGATGG + Intergenic
1171381895 20:24739932-24739954 GCTGCATTTTTTAACTTTGATGG + Intergenic
1172695912 20:36822629-36822651 GATTCATTTTGTTCCTTGGAAGG - Intronic
1175176087 20:57113070-57113092 GCTTGATTTTGTACATTTGAGGG + Intergenic
1176672271 21:9745520-9745542 GCTTCATTTTGTGAGTCTCAAGG - Intergenic
1176911353 21:14568934-14568956 GGTTAATTTTGTTATTTTGAAGG - Intronic
1178330584 21:31687105-31687127 TCTTCATTTTCTCAATGTGAGGG - Intronic
1179482421 21:41686636-41686658 GCTTCAATATATCGCTTTGAGGG - Intergenic
1180035132 21:45244001-45244023 CCTTCAACTTGTCACCTTGATGG + Intergenic
1180761850 22:18216583-18216605 GTTTCATTTTGTTTCTTTGGTGG - Intergenic
1180773817 22:18408027-18408049 GTTTCATTTTGTTTCTTTGGTGG + Intergenic
1180805169 22:18657571-18657593 GTTTCATTTTGTTTCTTTGGTGG + Intergenic
1180805577 22:18711837-18711859 GTTTCATTTTGTTTCTTTGGTGG - Intergenic
1181069876 22:20326741-20326763 GTTTCATTTTGTTTCTTTGGTGG + Intergenic
1181192919 22:21154952-21154974 GTTTCATTTTGTTTCTTTGGTGG + Intergenic
1181216522 22:21337622-21337644 GTTTCATTTTGTTTCTTTGGTGG - Intergenic
1183819636 22:40335072-40335094 GCTTTCTTTTCTCTCTTTGATGG + Exonic
1184883203 22:47325289-47325311 GCTTCAACATGTCTCTTTGAGGG + Intergenic
1203235649 22_KI270731v1_random:149001-149023 GTTTCATTTTGTTTCTTTGGTGG + Intergenic
950014599 3:9746756-9746778 TCCTCATTTTGTCACTGTGGAGG - Intronic
950890575 3:16400615-16400637 GCTTCATTTTCTCCCTCTGCGGG - Intronic
951082143 3:18465415-18465437 GCTTTATTTTGTCTCTCTAATGG - Intergenic
951999043 3:28763839-28763861 ACTTCTTTTTGTCACTTTAATGG + Intergenic
952439603 3:33312418-33312440 GCTTTATTTTGTTCCTTTGATGG + Intronic
952543969 3:34398400-34398422 GCTACATTTTGTCTTCTTGAGGG + Intergenic
954585276 3:51729900-51729922 GCTTTATTTTGTTCCTTTGGTGG + Intergenic
955678454 3:61474549-61474571 ACATCTTTTTGTCACCTTGAAGG + Intergenic
955865352 3:63376511-63376533 GCTTCTTTTTGTCTCTGTAAAGG + Intronic
955875633 3:63487752-63487774 TCTCCATTCTGTCACTTTGAGGG - Intronic
956191250 3:66610394-66610416 CCTTCAATTTGAGACTTTGAGGG - Intergenic
956655568 3:71547229-71547251 CCTTCATTTTAACACTGTGAGGG + Intronic
957311138 3:78520369-78520391 TCTTAATGTTATCACTTTGAAGG - Intergenic
957521395 3:81323126-81323148 GTTTCATTTTGTAACTTCAATGG + Intergenic
957629415 3:82699769-82699791 TCTTCATTTTGTATCTTAGAAGG + Intergenic
958864855 3:99487404-99487426 GCTTTATTTTCTTTCTTTGATGG - Intergenic
959137767 3:102445927-102445949 GTTGCATTTTCTCAATTTGAAGG + Intronic
959624787 3:108437692-108437714 GTTTCCTTTTGTCAGCTTGAGGG - Exonic
959865120 3:111258439-111258461 GCTTCTTTTTTTCCCTTTCATGG + Intronic
961872103 3:129996103-129996125 GCATCATTTGGTCATTTTGGGGG + Intergenic
962703885 3:138025372-138025394 TATTCATTTAGTCACTTTAAAGG + Intronic
963660630 3:148123697-148123719 ACTACATTATGACACTTTGATGG + Intergenic
965434152 3:168626512-168626534 GCTTCATATTTTCACATTTAGGG - Intergenic
967382913 3:188880361-188880383 ACTTTTTTTTGTAACTTTGAAGG - Exonic
969367064 4:6702197-6702219 TGTTAATTTTCTCACTTTGATGG - Intergenic
969975230 4:11092856-11092878 GCTTCAATTTGTGTCTTTCAAGG - Intergenic
970565615 4:17329633-17329655 GACTAATTTTTTCACTTTGAAGG + Intergenic
971169904 4:24223216-24223238 GCTTTATTTTCTCAATTTTATGG + Intergenic
971751648 4:30657148-30657170 GCGTCACTTTCTCACTTGGATGG - Intergenic
972946491 4:44263161-44263183 TCTTCATTTTGTCACATTATAGG + Intronic
976487942 4:85630372-85630394 TCTTCATTTTGTTCTTTTGATGG + Intronic
977779437 4:100963190-100963212 GAATCCTTTTGTCACTCTGAAGG - Intergenic
978590393 4:110317923-110317945 GCTTTTTCTTGCCACTTTGATGG - Intergenic
981226991 4:142308545-142308567 GATTTATTTTCTAACTTTGAGGG - Intronic
981669630 4:147273623-147273645 GCTTTATTTTGTTCCTTTGATGG + Intergenic
982302411 4:153893078-153893100 TCTTCATCTTATCACTCTGATGG - Intergenic
983665649 4:170179476-170179498 GCTTCATTTTGTTCCTTTGATGG + Intergenic
985402463 4:189606328-189606350 GCTTCATTTTGTGAGTTTCAAGG + Intergenic
986270760 5:6228654-6228676 GCTTCATTTTAGCGCTTAGATGG - Intergenic
988657622 5:33229470-33229492 GCTTTATTTTGGCACATTGGAGG - Intergenic
988682476 5:33497483-33497505 CCTTTGTTTTGTCACTATGAGGG - Intergenic
989497777 5:42129342-42129364 ATTTCATTTTCTCACTTTCATGG + Intergenic
989798249 5:45502166-45502188 GCTTCATTTTGTCATTGTTAAGG - Intronic
990449520 5:55921662-55921684 GCTTGATTTTGTCAATTTATCGG + Intronic
990653754 5:57931827-57931849 TCTTCATTTTTCCATTTTGATGG + Intergenic
990722467 5:58712224-58712246 GCTTCATTTTGCCAGTTTATGGG + Intronic
990780062 5:59350498-59350520 GCTTCCTTTTGCCACATTCATGG - Intronic
991393149 5:66171412-66171434 GTTTTATTTTGTCAGTTTTAAGG + Intronic
992048362 5:72920544-72920566 CTTTCACTTTTTCACTTTGAAGG + Intergenic
993547256 5:89229062-89229084 GCTTTATTTTGTTCCTTTAATGG + Intergenic
993759545 5:91775753-91775775 GCTTCATGTTGTCACTATGCTGG - Intergenic
994672107 5:102774763-102774785 AATTCATTTTGTCTCTTTGTTGG + Intronic
996184774 5:120462480-120462502 GGATTATTTTGTCACTGTGAGGG + Intergenic
998034510 5:138903075-138903097 GCTTCTTTATGTGACTTTGAAGG + Intronic
998994667 5:147857832-147857854 GCTTCATTTTCTTTCTTTCAGGG - Intergenic
999522762 5:152369152-152369174 GTTTCATTTTGTCAAATTAAGGG - Intergenic
999887328 5:155937320-155937342 GCTTCAATATGTGACCTTGATGG - Intronic
1000255342 5:159532960-159532982 GCTTCACTATGTGACATTGATGG - Intergenic
1001691642 5:173637307-173637329 GCCTCATTTTGTTACTTTTTGGG - Intergenic
1002458257 5:179358422-179358444 GCTTCAGTATGTGAATTTGAAGG - Intergenic
1002597488 5:180333906-180333928 GGTTCATTTTATCACTGGGAAGG + Intronic
1004666053 6:17749583-17749605 GCTACATTTTATCACCTTAAAGG + Intergenic
1004861691 6:19810205-19810227 GATTCATTTTCTCACTTGCATGG + Intergenic
1004946998 6:20626639-20626661 GATTCATTTTTACATTTTGAGGG + Intronic
1006597299 6:35202811-35202833 AGTTCATATTGTCACTTTAAGGG - Intergenic
1006909419 6:37554625-37554647 GCTTCATTTTCTAACTTTGGGGG - Intergenic
1008828684 6:55731197-55731219 GCTTCCTTCTTTCACTTTTAAGG - Intergenic
1010006089 6:70997336-70997358 GATTGATTTTGTCATTTTGGAGG + Intergenic
1010420051 6:75663047-75663069 ACTTAATTTTGAGACTTTGAGGG + Intronic
1012482486 6:99682592-99682614 CCTATATTGTGTCACTTTGAAGG + Intergenic
1012817086 6:104037655-104037677 GCTTCAAATTTTCACTTTGGGGG + Intergenic
1014314062 6:119842083-119842105 GCTTTATTTTGTTCCTTTGGTGG + Intergenic
1014732281 6:125046707-125046729 TATTCATTTTGTAGCTTTGAGGG + Intronic
1014947912 6:127518410-127518432 GCAGCATCTTGTCACTTTGTGGG - Intronic
1015547147 6:134372841-134372863 TTTTCTTTTTGTCACTTGGAGGG + Intergenic
1018315649 6:162554040-162554062 GCTTCATTTTGTTATTTTGGAGG + Intronic
1020770427 7:12385530-12385552 GCTTCATCCTGTCACCATGAAGG + Intronic
1021033644 7:15769334-15769356 GCTTTATTTTGTTTCTTTGGTGG - Intergenic
1021796872 7:24264364-24264386 AGTTCATTTTGCCACATTGAAGG - Intergenic
1022416330 7:30180606-30180628 GCTTAATATTGTTGCTTTGAGGG - Intergenic
1023342475 7:39235902-39235924 GCATCATTTGATGACTTTGAAGG + Intronic
1023505099 7:40890782-40890804 ACTTCATTTTGTTCCTTTGTTGG - Intergenic
1027356466 7:77360901-77360923 GCTTCATATTCTCTCTTTGCAGG - Exonic
1027676016 7:81159946-81159968 GATTCATTTTATCACTAGGATGG - Intergenic
1029747576 7:102525039-102525061 GTGTCAGTTTCTCACTTTGAGGG - Intergenic
1029765527 7:102624129-102624151 GTGTCAGTTTCTCACTTTGAGGG - Intronic
1031622914 7:123957286-123957308 ACTTCATCTTGTCATTCTGATGG - Intronic
1032314942 7:130829030-130829052 GCTTAATTTTGTCCCTTTGGTGG + Intergenic
1032618069 7:133496947-133496969 GCTGCTTTTTGTCTCTTTTAAGG - Intronic
1033707520 7:143903480-143903502 GCTTCCTTCTTTCACTTAGAAGG + Intergenic
1035164813 7:156980604-156980626 GCTTTATTTTGTTGCTTTAAAGG + Intergenic
1036040770 8:5078290-5078312 CCCTTATTTTGTCACTTTGGTGG - Intergenic
1037265820 8:17058642-17058664 AGTTCCTTTTGACACTTTGATGG + Intronic
1037410396 8:18589699-18589721 GCTGCTTCTTGCCACTTTGATGG - Intronic
1038550815 8:28466895-28466917 TCTTCATTTTGTCTCTTTCAAGG - Intronic
1039267588 8:35842214-35842236 GCTTTATTTTGTTCTTTTGATGG - Intergenic
1040678068 8:49775281-49775303 GCTTCCTACTTTCACTTTGAAGG - Intergenic
1040931510 8:52739899-52739921 GATTCATATTGTGGCTTTGATGG + Intronic
1041717768 8:60947654-60947676 GCTTTATTTTGTGACATTTAGGG + Intergenic
1042198495 8:66255681-66255703 GCTTCATTTTCCCACTGTTATGG - Intergenic
1042964710 8:74337894-74337916 TCTTCATTTTGTCCCTTTCAGGG - Intronic
1044129593 8:88505448-88505470 ACTTTATTTTGTCATTTTGTTGG - Intergenic
1044636409 8:94329287-94329309 GCTTAACTTTGTCTGTTTGAAGG - Intergenic
1046068881 8:109226418-109226440 GGTTCATTTTCTCATTTTGTTGG + Intergenic
1047796554 8:128262548-128262570 GTTTTATATTGTGACTTTGATGG + Intergenic
1049002577 8:139835432-139835454 GCCCCATTGTGTCACTGTGATGG + Intronic
1050621894 9:7462405-7462427 TCTTCATTTTGGAACTGTGAGGG + Intergenic
1051156629 9:14155065-14155087 GCTTATTTATGTAACTTTGAAGG - Intronic
1051436776 9:17042215-17042237 GGATCATTTTATCAGTTTGAGGG + Intergenic
1051546240 9:18279431-18279453 GATTTATTTTTTCACTTTGGTGG + Intergenic
1052234193 9:26189591-26189613 TCTTCATTTTGTTCCTTTAATGG - Intergenic
1053589044 9:39491815-39491837 GATTTATTTTGTTCCTTTGAAGG - Intergenic
1054577258 9:66873480-66873502 GATTTATTTTGTTCCTTTGAAGG + Intronic
1055712465 9:79078263-79078285 TCTTCATAGTGTCACTGTGAGGG - Intergenic
1057056801 9:91969335-91969357 GCTTTAGTTTGTGTCTTTGAAGG - Intergenic
1057337070 9:94164555-94164577 GCTTCATTTTTTACCCTTGAAGG - Intergenic
1186151786 X:6682361-6682383 GCTTCATTTTTTGACTTTGGTGG - Intergenic
1186361855 X:8850541-8850563 GCTACTTCTTGTCACTTTTAAGG - Intergenic
1192531269 X:71888773-71888795 GCTTCCTTCTTTCACTTTTAAGG - Intergenic
1194260975 X:91695227-91695249 GCTGCATGTTTTCACTTTAAAGG - Intergenic
1197096147 X:122598107-122598129 ACTTCATTTAGTCACTCTAAAGG - Intergenic
1197181111 X:123538544-123538566 GCTTTATTTTGTTCCTTTGGTGG + Intergenic
1197809090 X:130425641-130425663 GGTTCATTTGGTCACTGTGAAGG + Intergenic
1197875466 X:131099665-131099687 TCTACATTTTGTCTGTTTGAAGG + Intergenic
1200387677 X:155909296-155909318 TCTTCATTTTGTAAGTTTGGTGG + Intronic
1202233875 Y:22687104-22687126 GCTTCATTTGGGCATTTTTAAGG + Intergenic
1202309281 Y:23509054-23509076 GCTTCATTTGGGCATTTTTAAGG - Intergenic
1202561520 Y:26161538-26161560 GCTTCATTTGGGCATTTTTAAGG + Intergenic